For your monster's hair, you chose Allele 2: TAC ATA CGC GTAATT 2. Fill in the mRNA and partial protein for your monster's hair color. DNA ТАС АТА CGC GTA ATT MRNAX ProteinX

Q: Biology Section 12BC / School Year / We. kl197624 All changes saved 8. In Labrador Retrievers, coat…

A: Gene interaction: When there is a change in a single trait by the influence of more than two…

Q: Can you please answer this question

A: DNA is a nucleic acid which possess the information which determines the characteristics of an…

Q: t for them to get a robust exp chat these genetic marks were ow. Draw the distribution of r ree…

A:

Q: DNA SEQUENCE IN FUNCTIONAL (UNAFFECTED) CFTR ALLELE DNA Gene Base ancestral Sequence:…

A: Since you have multiple questions, we're answering the first one for you. If you want any other…

Q: ESTION 12 O words or fewer, explain why we think that RNA, and not DNA, was the hereditary material…

A: RNA and DNA are nucleic acids. RNA is a single strand molecule and DNA is a double stranded…

Q: f you have a genome that is 21% Adenine, what percent of the genome is Thymine?     100%     21%…

A: Chargaff's rules states that DNA from any cell of all organisms should have a 1:1 ratio (base Pair…

Q: A mutation results in an enzyme that is partially active compared to the wild -type allele. This…

A: A mutation is the alteration of the nucleotide sequence of the genome of an organism, virus or…

Q: Cells in your stomach cells produce the digestive enzyme called pepsin. Cells in your bones do not…

A: Cells is considered to be the basic fundamental unit of life. Many cells come together to form…

Q: Genes are arranged in a chromosome: Select one: O a. Irregularly O b. Orderly O c. Linearly O d. In…

A: Gene can be defined as a functional unit of heredity or inheritance .These are the small segments of…

Q: During the ________ phase, the cell accumulates building blocks and energy resources to copy its…

A: INTRODUCTION S phase This is the phase in which DNA is replicated, occurring between G1 and G2.

Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT

A:

Q: A wrinkle-seeded plant (rr) is crossed with a round-seeded plant (Rr). WHAT is the punnet squar for…

A: An allele is a variant form a gene and is present in two forms: dominant and recessive. The dominant…

Q: Figure 1-15 shows the family tree, or pedigree, for LouiseBenge (Individual VI-1) who suffers from…

A: Arterial calcification due to deficiency of CD73 is a rare genetic disorder. Individuals suffering…

Q: gment shows where a number c between those cut sites in base Bem het Bem H 700 800 1000 1100

A: A restriction enzyme, also known as a restriction endonuclease or restrictase, is an enzyme that…

Q: In our original lab, the plan was to collect cheek cells from everyone and test for the ability to…

A: PTC - Phenylthiocarbamide also known as Phenylthiourea , the chemical structure of PTC resembles…

Q: How would one best define the chromosomal location of a GENE? Select an answer and submit. For…

A: A. Located on a pair of homologous chromosome.

Q: hat happens when one nucleiotide is lost or changed from the middle of a gene? Describe to me, or…

A: When a deoxyribonucleic acid factor is destroyed or altered in such the simplest way that the…

Q: Refers to the two strands of DNA double helix. Please choose one answer only.  A. Nicks B. Templates…

A: Introduction: As it relates to genomics, the phrase "double helix" is used to define the actual…

Q: Which DNA fragment is e smallest? Negative End #1 12 13 <14 Positive End

A: Answer: AGAROSE GEL ELECTROPHORESIS = This is a technique which we use to separate different…

Q: | CHROMOSOME GENOTYPE MENDEL ALLELE GENETICS I START ONE MEMBER OF A PAIR OF GENES FROM - THE…

A: The branch of science that deals with the study of the genome and its effects are called Genetics.…

Q: In this gel, individual 1 would show up as having (X,Y) repeats in the CODIS database ALLELES # 1…

A: Allele is the alternate form of gene.

Q: A segment of DNA from theinterior of a single strand is shown inFigure Q4–1. What is the polarity of…

A: DNA, is a nucleic acid it is deoxyribonucleotide, it is called deoxy because the 2 carbon position…

Q: Similarities in________ are the basis of similarities in traits. a. karyotype c. the double helix b.…

A: similarities in ________are the basis of similarities in traits

Q: Explain why the corn kernel in Figure 18.34d is variegated, with some areas colored and some areas…

A: Transposons are the sequences of DNA that are able to move from one position to other. They are…

Q: What is the smallest unit of heredity (genotype)?a. chromosome b. gene c. codon d. nucleotide

A: Chromosomes are the carrier of genetic material deoxyribonucleic acid (DNA). They are coiled in…

Q: Genes are located in the chromosomes of cells, with each pair containing two variants called Each of…

A: Genetics is the subdomain of biology that deals with the heredity, genes, genetic variations, and…

Q: Both alpha globin and beta globin are examples of gene duplication. Ancestral globin gene mes BI V…

A: Asked : Given statement is true or false.

Q: nucleotide is in the left column, and second codon nucleotide is on top. The m allele sequences are…

A: Sense strand of the coding strand is the segment of DNA that carries the code that can be…

Q: 14 Linkage Between Genes Testcross: RL/ rl X rl/ rl

A: According to the law of independent assortment, the alleles of different genes segregate…

Q: Select and order the images representing 1. the alleles that code for sickle cell anemia 2. the…

A: Sickle cell anemia (SCA) is caused by a mutation in the gene that codes for the beta-globin…

Q: 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3'   There are two…

A: Introns are the intervening or noncoding sequence present between the coding sequence.

Q: which of the follocoing waeleng ths ranges is use d to measue absorbence of DNAĄ 10 0 - 2oonm 200…

A: Deoxyribonucleic acid(DNA) is one of the most important biochemical compounds for living cells. It…

Q: Which gene type is INCORRECTLY matched with its type of genomic sequence? a. FRNA gene: moderately…

A: Answer: Genomic sequences = These are the sequences present in chromosomes which codes for a…

Q: G. Aureliano has a mutation in the blue-shaded nucleotide in the TEMPLATE DNA sequence. Instead of a…

A: Introduction :- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…

Q: 08 PART A Figure 1. Pedigree Key Key Figure 2. Family A Figure 3. Family B вто 1a 2a 1b 2b 3a 4a 5a…

A: Pedigree analysis A Pedigree analysis represents the inheritance pattern of a trait. It is used to…

Q: ) whet will be will be the Amout o DNA conteing Product if melogk inG,-Phose ? metonir - 30lg DNA

A: Mitosis - equational division (2n =&gt; 2n) Meiosis - reductional division (2n =&gt; n)

Q: 5. A wrinkle-seeded plant (rr) is crossed with a round-seeded plant (Rr). Wrinkle-Seeded Plant…

A: A) Genotype- It is the set of genes that we have inherited from our parents and will pass on these…

Q: What is the complementary DNA for the following: 5' ATG CCA GCT CAT 3'  A. 5'ATG CCA GCT CAT 3' B.…

A: DNA is a double-stranded molecule with two strands running anti-parallel to each other. When one…

Q: cludes the beginning of a sequence coding n that changed the C marked by an asteris

A: 16) the sequence of protein must be written and the C is replaced with A. So the sequence is…

Q: A wealthy elderly couple die together in an accident. Soon, a man shows up to claim their fortune,…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Describe what DNA is?draw/use a diagram to explain

A: The genetic information is stored and transferred from one generation to another through a substance…

Q: Queston have discovered you a called "keafi," Whese protein product looks like a fruit. You isdlae…

A:

Q: A female born with Angelman syndrome carries a deletion in theAS gene (i.e., the UBE3A gene). Which…

A: Angelman syndrome: It is a genetic disorder which is caused seizures, intellectual disability,…

Q: Paris has her mother's brown hair and her father's blue eyes. Paris inherited these traits from her…

A: Genes control the genetic characteristics of an organism.  Genotype is the genetic characteristics…

Q: In regards to satellite DNA, the major difference between a LINE sequence and a SINE sequence is the…

A: In molecular biology, there are two types of genes ,coding and noncoding. Coding genes helps in the…

Q: 24) Sickle cell disease is a recessive trait. Linda has sickle cell disease. Her brother does not.…

A: For being affected by sickle cell disease, an individual needs one disease-causing gene from his…

Q: a | B mes B a Gy Ay YB a-Globin gene family on chromosome 16 B-Globin gene family on chromosome 11

A: A phylogenetic tree is a diagram that depicts the lines of evolutionary descent of different…

Q: Product of gene mutation orthologous genes paralogous genes pseudogenes O all of these

A: Introduction A Mutation Occurs When The Sequence Of DNA Is Altered. Mutations Can Occur As A Result…

Q: B. Make identical strands of DNA CCTAT ATCTC TCTAT ATCTC TCATA CTGTG TGTCT CTATA (original) (new) C.…

A: The newly synthesized strand would always be complementary to the original DNA (and with opposite…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.