hat is Embden-Meyerhof pathway of RBC metabolism, explain as simple as possib
Q: 1 Suppose that you have 1ml of a buffer solution with a pH of 6.8 and you add 1ml of 2% starch…
A: Salivary amylase is an enzyme that works on catalytic digestion of starch. Salivary amylase…
Q: Retroviruses, like the HIV, contain an enzyme called reverse transcriptase. Explain the flow of…
A: Retroviruses are viruses with an enzyme known as reverse transcriptase. Transcription is the process…
Q: 2. ( To the right is a schematic diagram of His the active site in the Michaelis complex of a-chy-…
A: Chymotrypsin is a protease that cleaves a peptide at the C-terminal of all aromatic amino acid.…
Q: What is the terminal electron acceptor in photo- phosphorylation?
A: By activating PSII, photophosphorylation converts ADP into ATP using the energy of sunlight. It…
Q: 1. Proteins act as structural components such as keratin of hair and nail, the collagen of the bone…
A: "Since you have posted a question with sub-parts we will answer the first 3 question for you. If you…
Q: Spectrophotometric determination of riboflavin at max 445 nm.
A: When Lab scientists have to be measured total protein by UV-spectroscopy some important things…
Q: Where would the catalase enzyme perform best- in the human blood stream OR in the human stomach?…
A: Catalase is common enzyme found in all aerobics and it convert reactive oxygen species H2O2…
Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…
A: Molisch's test is the specific test for Carbohydrates which give purple colour ring on addition of…
Q: How does compromised pyruvate kinase activity lead to anemia? (3 sentences)
A: Pyruvate kinase is a glycolysis enzyme that plays a role in the last phase. It catalyzes the…
Q: How does 2, 4 Di Nitro Phenol raise human body temperature when used in a weight-loss program?
A: 2,4-Dinitrophenol (DNP) is a yellow, crystalline substance with a sweet, musty odour. It sublimes,…
Q: Section B: True / False (5 marks) 1. Primase has a DNA dependent RNA polymerase activity. 2.…
A: True or false statement Primase is a kind of RNA polymerase that is involved in the replication of…
Q: Which organ typically does not use fatty acid oxidation as a source of ATP? Liver Brain…
A: Fuel molecules are those biomolecules that upon oxidation yields the body with ATP. Our body uses 4…
Q: Match the best possible fit for the following Animal virus replication stages. A. Attachment B.…
A: Viruses contain nucleic acid/ribonucleic acid in the core region while the exterior/…
Q: Derivatives of purines and pyrimidines make up the base component of nucleotides. Select the…
A: Purines and pyrimidines are nitrogenous bases that makeup two types of nucleotide bases in DNA and…
Q: How is a “committed step” defined in the context of a metabolic pathway and why are they important?…
A: A metabolic pathway is a series of biochemical reactions that are interconnected by their…
Q: 5. Amino acid methionine is used as medicine due to its lipotropic ellect («removes» fat excess from…
A: The orange structure is the liver The red arrows indicate the transport is happening via the blood…
Q: Which statement is FALSE concerning glycolysis? Group of answer choices It is activated by high…
A: Glycolysis isa catabolic pathway that occurs in cytosol by breaking down of glucose into pyruvate…
Q: a) Give an appraisal of prokaryote cell lines as recombinant polypeptide expression systems. (b)…
A: The bacterial expression system is widely used for the recombinant expression of mammalian proteins.…
Q: What polysaccharide is used as storage of carbohydrates in humans and animals? Group of answer…
A: Carbohydrates – fibre, starches, and sugars — are nutritional elements that the body converts into…
Q: Question 3 -- / 1 What form(s) of chemical energy are generated during cyclic photo-phosphorylation?…
A: Introduction: Photophosphorylation is the process by which photosynthetic organisms use the energy…
Q: A. Effect of pH with enzymatic activity. Include example of enzymes optimum pH. B. Effect of…
A: The enzymes are biological catalysts, that enhance the rate of biochemical reactions. The factors…
Q: Describe surroundings at home which reminds you about biochemistry and relate the situation to…
A: related to this : proteins A situation to describe : Cooking
Q: what transport proteins are involved is getting ca2+ out of cytosol
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: The picture below shows the body's response to acute stress, which is to release adrenaline…
A: Introduction: Adrenergic neurons release norepinephrine as the primary neurotransmitter. These…
Q: At which position(s) are amino acids limited to those Which amino acid(s) are more commonly found at…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: With the aid of diagrams describe the signalling pathway involving inositol 1,4,5 trisphosphate from…
A: Membrane phospholipids can act as precursors from which second messengers can be produced during…
Q: Classify the following amino acids base on their side chain if it's either -Non-polar aliphatic R…
A: Amino acids are the molecules that contain an amino group and a carboxylic group linked through the…
Q: Review method used to increase the solubility of a drug under the following headings co solvents PH…
A: Bioavailability is a powerful determinant of drug absorption. It represents the administered dose…
Q: Why egg whites and milks are used as antidotes for heavy metal poisoning?
A: Heavy metal poisoning is a process in which an organism is exposed to excessive amount of heavy…
Q: Which of the following has the strongest tendency to gain electrons? Select one: O a. FAD O b.…
A: The electrons released from NADH and FADH2 are transferred to molecular oxygen in ETC to generate a…
Q: HN-CH- HN-ÇH-C- -OH HN- CH 1 2 3.
A: Each amino acid has a N-terminal (-NH2 group), a C-terminal (-COOH group) & a R-group or the…
Q: What does protein function in the human body?
A: Proteins are made up of amino acids or we can say that amino acids are the building block of…
Q: A. They carry unneeded cholesterol back to the body's liver, where it is eliminated. 7. Which…
A: Lipids are amphipathic molecules that contain both polar and non-polar parts present in them. Lipids…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: H o-H H Н-С-н `cc- .と、 H toluene phenol エ エ 工王 \\
A: Retention factor The amount which each component of a mixture travels can be easily quantified using…
Q: Н Но H OH HO, OH H HN- a. Glucocerebroside CH3 OH H3C -N-CH,- CH2-0-P-01 HN CH3 b. Sphingomyelin
A: Glucocerebrosides are lipid derivatives composed of sphingosine, fatty acid and a glucose residue.…
Q: How many molecules of water are produced by the electron transport chain during the complete aerobic…
A: Stearate is saturated fatty acids. It is metabolized by beta oxidation in the cytoplasm. It releases…
Q: Enzymes accelerate the rate of a reaction by: a. lowering the number of molecules with lower…
A: Introduction: Enzymes are biological catalysts that fasten the speed of the chemical reaction. They…
Q: Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…
A: The structure of pyrimidine/ purine nucleoside or pyrimidine/ purine nucleotide with ribose or…
Q: 2. Explain the difference between saturated and unsaturated fats.
A: Fats often refers to triglycerides which is esters of glycerol and fatty acids. One glycerol can be…
Q: Match the following descriptions to the given choices. A. Aldosterone The first molecule in the…
A: 1. The first molecule in the biosynthesis of steroids that contain the…
Q: production of Ribose 5-phosphate in the Pentose Phosphate Pathway is needed in the synthesis of…
A: Pentose phosphate pathway, also called the hexose monophosphate shunt or phosphogluconate…
Q: What is another name for the glycolate pathway?
A: The process of respiration that is initiated in the chloroplast and take place only during day is…
Q: Can you please briefly describe the reaction mechanism that permits the detection of reducing sugars…
A: Fehling's reagent is a reagent commonly employed in differentiation of water soluble carbohydrates…
Q: What diseases are the related protein deficiency in the human body? Explain their rationale.
A: Protein deficiency occurs in the human body when the body does not get enough amount of protein that…
Q: HN- CH H2N-CH-c-OH HaN — сн—с— он | Н-N— сн—с—он CH2 CH2 ČH2 CH2 CH2 CH2 NH2 ÓH A B D H2N-CH-C. -ОН…
A: Aminoacids are the building blocks of proteins. They have two functional groups along with side…
Q: of Mg2+.Classify each analyte based on its level in the soil sample
A: Amount of soil sample = 2.65g In mg = 2.65 × 1000 = 2650…
Q: A mixture of Alanine (pl 6.02), Glutamic Acid (pl 3.22), Glycine (pl 5.79), Lysine (pl 9.74) and…
A: Ion exchange chromatography is used to separate molecules based on their net surface charge.
Q: Question 3 Aldosterone regulates sodium, potassium, and chloride ions in tissues True False
A: Aldosterone is a hormone which is secreted by the adrenal glands. Aldosterone secretion is increase…
Q: Which of the following substances ATP, CoA-SH, FAD and NAD+ have the subunits in their structure?…
A: FAD/FADH2, NAD+/NADH, and NADP+/NADPH are cellular electron carriers and ATP is the energy currency…
What is Embden-Meyerhof pathway of RBC
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Case Study #1: Ms. C is a 19-year old college student. She was brought to the ER with symptoms of nausea, vomiting and gastric pain and diarrhea for two days. Upon interview, patient revealed that she ate street foods a few hours before the symptoms developed. She is dehydrated with urine output of 500 ml/day, pale and dry skin, her temperature is 38.2 C, and stool culture revealed Salmonella infection. She was given IV fluids and loperamide. 1. Make a SOAP Chart for this case9. Case Study: A male patient experienced body malaise, joint pains. He consulted a family medicine physician and was later referred to a hematologist, where bone marrow examination revealed a 10% plasma cells. Myeloma proteins and Bence- Jones protein were demostrated in the blood and urine respectively. a. Is the plasma cell count above, within or below normal/reference value? b. Give the reason why there is higher than normal myeloma proteins in the blood? c. Give the reason why a high level of Bence- Jones protein is detected in urine? d. On the basis of the laboratory results, what do you think is the disease/disorder of the patient?Case Study #1: Ms. C is a 19-year-old college student. She was brought to the ER with symptoms of nausea, vomiting and gastric pain, and diarrhea for two days. Upon interview, the patient revealed that she ate street foods a few hours before the symptoms developed. She is dehydrated with a urine output of 500 ml/day, pale and dry skin, her temperature is 38.2 C, and stool culture revealed Salmonella infection. She was given IV fluids and loperamide. Make a SOAP (Subjective, Objective, Assessment, and Plan) Chart for this case. What is salmonellosis? What causes it? How is it diagnosed? What are the Symptoms? How is it managed? Discuss how salmonellosis can be prevented.
- Case Study Identifying Intravenous Delivery Systems, Administration Method, Infusion Rate, Stability/Compatibility, and Labelling of an Intravenous Admixture Mr. Blair, a 75-year-old man weighing 60 kg, was admitted to the Gastroenterology Unit of the Miracle Hospital with severe diarrhea due to food poisoning. After examining Mr. Blair, Dr. Clark ordered IV fluids of D5W 1000 mL q12h, for the next three days with added electrolytes, such as potassium, sodium, calcium, and magnesium, since Mr. Blair was severely dehydrated. In addition, suspecting Salmonella poisoning, Dr. Clark prescribed Septra, 500 mg IV q12h, to be mixed in the D5W electrolytes fluid admixture. What considerations must be taken into account prior to admixing this order? (NAPRA 6.1, 6.2, 8.3, 9.2) 2.If the drug is determined to be incompatible with D5W and electrolytes, what IV delivery system and/or administration method would you use to administer the medication? (NAPRA 2.3, 6.1, 6.2, 8.3, 9.2)…Case Study 5:A 4-year-old boy was seen in the public health clinic because of intermittent bouts of diarrhealasting almost 4 weeks. The mother did not note any bright red blood in the stool. The child waspale, listless, and had a protuberant abdomen. He had a number of small erythematous vesicleson his feet. His mother said that he sometimes ate dirt and always had a good appetite. The familylived in a rural part and had a well from which they got their drinking water. This part of thecountry had only recently been connected to the local city’s sanitation system. The physicianinitially ordered a complete blood count with an elevated Eosinophil count. The physicianordered a stool culture for bacterial pathogens and stool examination. The bacterial culture wasnegative for enteric pathogens, but the stool examination revealed parasitic organisms and thepresence of Charcot-Leyden crystals. Diagnosis: Capillariasis Causative Agent: Capillaria philipinensis Case study presentation should…Case study 1. Present a treatment or solution to address such case through the guiding questions after the case.
- 7. Compare and contrast deep vein thrombosis (DVT) and venous thromboembolism (VTE) in the post-operative patient. Disease Deep Vein Thrombosis (DVT) Pulmonary Embolism (PE) Etiology Pathophysiology Clinical Manifestations ComplicationsCase study HPI: 73 year old Asian male presents to your clinic for a follow-up appointment. He is c/o dyspnea. SOB has gradually increased over the last 4 days and is worse when lying down in bed. He cannot walk more than 25 feet without SOB. He sleeps downstairs in a recliner, mostly so he doesn’t have to go up the stairs. He denies fever, chills, chest pain, palpitations, dizziness constipation, diarrhea, abdominal pain, or nausea. Reports 7 kg weight gain over the past week, chronic nonproductive cough. PmHx: heart failure, DM type II, HTN, CAD, MI, CKD FHx: Father died of MVC at age 62, mother died of heart failure at age 79, sister (age 65, alive) with HTN SHx: never used tobacco, etoh 1-2 drinks/month, retired, married with 1 daughter (ages 41, healthy), used to walk at the neighborhood track, but can’t anymore; eats mostly fish and vegetables, does not use salt. Meds: carvedilol 3.125mg BID lisinopril 40mg daily…CASE STUDY 15.6 A 52-year-old woman presents with a localized swelling and purulent abscess in her right hand and enlarged lymph nodes in her axial region (under the armpit). She sustained a small puncture wound while replanting rose bushes 1 week earlier. She has repeatedly cleaned and dressed the wound with antibiotic treatment, with no success. The physician collects an aspirate from the abscess. Gram stain reveals gram-positive cocci in clusters Laboratory data follow Catalase: Positive Coagulase: Latex positive Multiple Choice Questions From the patient's history and laboratory results, which organism is the most likely cause of the infection. Micrococcus luteus Staphylococcus aureus Staphylococcus epidermidis Sporothrixschenckii ANS: b. Staphylococcus aureus What other clinical condition could arise from this injury if treatment were not initiated? No concerns; infections are self-limiting. Patient may develop a bacteremia, resulting in a more serious infection.…
- Case Study 2Respiratory DrugsBrett is a 12 y/o boy with a history of asthma, diagnosed 2 years ago. He is an outgoing, active boy and participates in a swim club and soccer, but he has a difficult time adjusting to the limitations of his asthma. He has learned to control acute attacks by using albuterol (Proventil) metered-dose inhaler, and because his asthma is often triggered by exercise, he has been using a budesonide (Pulmicort) inhaler and taking montelukast (Singulair). After competing in his swim meet at the local indoor pool, Brett began experiencing respiratory distress. He alerted his coach, who retrieved the albuterol inhaler from Brett’s backpack. After two inhalations, Brett was still in distress and the rescue team was called.On admission to the emergency department, Brett is in obvious distress with pulse oximeter readings of 90% to 91%. He has nasal flaring and bilateral wheezing is heard in is his lung fields, pulse rate is 122 beats/min, and he is orthopneic.…Case Study 3 – Congestive Heart Failure Dottie is a 78-year old CHF patient. She has been exercising with your facility for several years now. She had a CABGx3 in 2020. She came in today with a 5 lb. weight gain since yesterday when she weighed on her home scale this morning. Her meds include- Lipitor, Procardia, and Lasix. (Cholesterol, Calcium channel blocker Hypertension, and Diuretic, respectively) Her blood pressure is 132/88 and her HR = 102; Her weight is 196, up from 191 when last measured. She is a pleasant, overweight individual who enjoys walking on the treadmill and visiting with other members of your facility. 1. What are specific considerations for someone with CHF and exercise? How is the exercise prescription any different from the apparently healthy adult prescription? 2. What is your biggest concern with Dottie today and how would you handle this concern(s)?B. RELATED QUESTIONS:1. Discuss what is COPD and its pathophysiology 2. Discuss the pharmacologic and nonpharmacologic interventions for COPD