Describe surroundings at home which reminds you about biochemistry and relate the situation to biochemistry. (related to this : proteins) A situation to describe : Cooking
Q: A. Effect of pH with enzymatic activity. Include example of enzymes optimum pH. B. Effect of…
A: The enzymes are biological catalysts, that enhance the rate of biochemical reactions. The factors…
Q: one more example of chemical (besides acids and alkalis) which can also affect DNA stability.…
A: DNA can be denatured by process of separating dsDNA into single strands, factors like temperature,…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: What is the dna strand sequence for phosphate sugar backbone?
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Match lipid descriptions in column A with the phospholipid types in column B. H is attached to the…
A: Phospholipids have a glycerol backbone and are the major constituents of the cell membrane.
Q: +3 -1.5 +1 +2 -1 +1.5
A: Amino acids are organic molecules having an amino group and an acid group. Amino acids are…
Q: Question 17 In a glucometer, glucose oxidase catalyzes the redox reaction of glucose to form…
A: Glucometer is the instrument used to measure and display the amount of glucose level in the blood.…
Q: Given Tagatose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Tagatose is ketohexose i.e. it has 6 carbons and is a ketose sugar.
Q: a. Name the phosphoinositide generated through the action of PI-5 kinase. b. Name the products…
A: Phosphatidylinositol (PI)-related signalling is important for survival, cell proliferation,…
Q: A peptide was cleaved into two smaller peptides with cyanogen bromide (CNBr) and into two different…
A: The given peptide sequences are: CNBr 1: Gly-Thr-Lys-Ala-Glu CNBr 2: Ser-Met Tryp 1:…
Q: CHALLENGE QUESTION I: Smurf hemoglobin has a p50 of 30 torr and has 8 subunits, instead of the usual…
A: Consider the Protein (P) is getting bound by the Ligand (L) to form the Protein-Ligand complex (PL)…
Q: If the extracellular K* concentration increases to 20 mM, what would be the Nernst Potential of K*…
A: Membrane potential is the voltage difference between inside to outside of the cell. In absence of…
Q: When specific conditions are met, the creation of peptide bonds rather than the hydrolysis of…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: 2. coined by Francis Crick? Does SARS-CoV-2 conform to the central dogma of molecular biology that…
A: The central dogma of molecular biology was proposed by Francis Crick and was the first model to…
Q: N-glycosyltransferase attaches which sugar to the base oligosaccharide to synthesize the B antigen?…
A: The antigens A, A1, B, and AB, which are expressed differently on the surface of RBCs, other cells,…
Q: POST-LAB QUESTIONS 1. When a reducing sugar reacts with Benedict reagent, what organic product is…
A: 1. The Benedicts reaction with reducing sugar is given below. Reducing sugars can be either in…
Q: In the Ames test shown in Figure 16-17, what is the reason for adding the liver extract to each…
A: Ames test is performed to detect the ability of a chemical to cause mutation in the DNA. Histidine…
Q: What is the most stable nitrogenous base pairing?
A: Base can be purines (adenine and guanine) two ring structure and pyrimidines (cytosine and thymine).…
Q: While fatty acids are most often formed by the condensation of_-carbon units, isoprenoids are…
A: Fatty acid and isoprenoid both are class of lipid and plays an important role in the metabolism of…
Q: In a 25 uL reaction, you desire a buffer concentration of 1X. You will be supplied with a stock…
A: Dilution of buffer solution or any solution can be done to obtain a diluted solution with varied…
Q: What is enzyme specificity?
A: The metabolic processes involve several metabolic pathways each with several chemical reactions…
Q: Match the following descriptions to the given choices Synthesized from a steroid molecule A. Vitamin…
A: Vitamin is an organic substance and an essential micronutrient that an organism needs in small…
Q: Calculate the standard free-energy change, deltaG°, for the reaction in which acetaldehyde is…
A: Standard free energy of biochemical reaction is related to standard reduction potential ∆Go = -nFEo…
Q: Only one of the statements below is correct; which one? Two solutions are hypotonic when they have…
A: Tonicity is a parameter of the effective osmotic pressure gradient, which is the difference in water…
Q: Think about ONE possible consequence with a brief explanation if the primers were not removed after…
A: Introduction: DNA is a genetic material that defines every cell. Before a cell duplicates and is…
Q: You want 235mL of a solution that consists of 10% BSA, 2.37mM KCl and 120µM EDTA. You have stock…
A: BSA is a globular proteins which is a well studied proteins and used as standard protein molecule in…
Q: An RNA produced from a fragment of DNA has the sequence of 5'AAUUGGCU3'. The sequence of the…
A: Genetic information in our body is stored as DNA. DNA multiples itself by replication. DNA is used…
Q: uan used the ABO blood testing kit to determine his blood type. His test showed the following…
A: ABO blood grouping in humans: The RBCs of the one with blood group A have antigen A and the plasma…
Q: Calculate the number of ATPATP generated from one saturated 1212‑carbon fatty acid. Assume that each…
A: Fatty acids are broken down through beta-oxidation in mitochondria. The end product of…
Q: 3. A 2-year-old child was taken to the hospital. His mother said that he vomited frequently,…
A: The inborn error in metabolism occur due to mutation in a gene of the metabolic pathway.
Q: What might be the dangers in using supplements to get DHA in your diet?
A: Docosahexaenoic acid (DHA) is an omega-3 fatty acid found in cold-water fish like tuna and salmon,…
Q: Fermentation occurs when is in too scarce amount to continue Its purpose is to re-generate so that…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Which reaction in glycolysis produces ATP as a product? Group of answer choices hexokinase…
A: Glycolysis : Process in which the glucose gets broken to produce pyruvate, ATP, NADH and water.
Q: Match the following lipids with their functions
A: Lipids are the various organic compounds which are insoluble in water. These are- fats, waxes,…
Q: Which metabolic pathway converts glucose into two molecules of pyruvate and ATP? Group of answer…
A:
Q: Gene X is expressed in the developing brain, heart, andlungs of mice. Mutations that selectively…
A: Mutations occur as a result of errors in DNA or viral replication, mitosis, meiosis, or other types…
Q: Which statement about gluconeogenesis is FALSE? Group of answer choices For starting materials, it…
A: Gluconeogenesis is the biochemical pathway by which pyruvate is converted into glucose.
Q: The picture below shows the body's response to acute stress, which is to release adrenaline…
A: Introduction: Adrenergic neurons release norepinephrine as the primary neurotransmitter. These…
Q: a deaminating agent 5-BU is that can base-pair ike cytosine or like if 5-BU is cytosine incorporated…
A: 5-Bromo Uracil and nitrous acid are mutagenic agents. It means both of these agents cause mutation…
Q: LIPIDS Functions Chemical Components 1. 1. 2. Two Primary Categories of Lipids 2. 3. 3 4. Two…
A: Functions of lipids: 1. Storage of energy 2. Transmit nerve impulses 3. Structure of cell membranes…
Q: Give a brief note on Alcohols? Answer should include all pharmacological studies, everything which…
A: The term "mechanism of action" in pharmacology refers to the unique biochemical interaction by which…
Q: The free energy of folding of a protein is -17kJ/mol. What tenoerature (C) do you have to heat the…
A: Protein folding is related to protein stability that is the thermodynamic stability, not the…
Q: Aspartic acid has a side chain bearing a carboxylic acid group; its pKą is ~4. The alpha-carboxylic…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Match lipid structures in column A with its lipid type in column B esters of fatty acids with long…
A: The question include match the following with different options. The correct options are mentioned…
Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…
A: Molisch's test is the specific test for Carbohydrates which give purple colour ring on addition of…
Q: When can we say that it is an essential amino acids and non essential amino acid? Choose two amino…
A: Introduction: Amino acids are biomolecules that contain an amino and a carboxyl group-containing a…
Q: Hormones, such as testosterone, estradiol and progesterone are examples of steroidal lipids. O True…
A: Leydig cells secrets testosterone in male body. In female body ,granulose cells of the ovaries…
Q: What part of the protein sequence leads to different functions
A: Proteins are peptides , composed of monomers of polymers,Protein function is directly related to the…
Q: Enumerate 10 examples of oxidation-reduction reaction that occur everyday.
A: Oxidation-Reduction reaction is also called redox reaction involves transfer of electron between two…
Q: 10. Isoniazid (MAO inhibitor) is prescribed to the patient with Parkinson discase. What does cause…
A: Parkinson's disease is commonly seen in adults after the age of 50. Parkinson's disease is known to…
Describe surroundings at home which reminds you about biochemistry and relate the situation to biochemistry.
(related to this : proteins)
A situation to describe : Cooking
Step by step
Solved in 2 steps
- Describe surroundings at home which reminds you about biochemistry and relate the situation to biochemistry. (related to this : proteins) A situation to describe : Cooking egg (Denaturation)Describe surroundings at home which reminds you about biochemistry and relate the situation to biochemistry. (related to one of this : water, acid base, amino acid, proteins) Choose a sitution to descibe, eg: laundry, baking, shower, cooking etc.The macromolecules that serve in the storage and transmission of genetic information are __________. carbohydrates lipids membranes nucleic acids proteins
- A protein is composed of amino acids, which are held together by the covalent bonds known as: phosphodiester bonds ester bonds glycosidic bonds ether bonds peptide bondsDefinition of Proteins What is the Formation / Synthesis and breakdown: Amino acids Amino group, carboxyl group, R-group/ side chain/body/core DeaminationHow many types of biochemistry are there
- In DNA, adenine is the complementary base for ________ ,andcytosine is the complement for ________a. guanine, thymine b. uracil, guanine c. thymine, guanine d. thymine, uracilIn your house, list a food and substances that contain biological macromolecules in them. Write at least 10 each macromolecule on the table provided below. Lipids Carbohydrates Nucleic Acids ProteinsPlease help me identify the correct level each image represents. Answer Choices are: Secondary Structure Quaternary Structure Primary Structure Tertiary Structure
