How often, on average, will the endonuclease AluI, which cleaves the sequence 5’ AGCT 3’, cut normal DNA (assume equal amounts of each base)? (In other words, what will the average fragment size be after cutting?) Group of answer choices 256 bases 12 bases 40 bases 16 bases none of these

How often, on average, will the endonuclease AluI, which cleaves the sequence 5’ AGCT 3’, cut normal DNA (assume equal amounts of each base)? (In other words, what will the average fragment size be after cutting?) Group of answer choices 256 bases 12 bases 40 bases 16 bases none of these

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Related questions

Q: Below is a sequence of DNA.…

A: Introduction :- Adenine (A), thymine (T), cytosine (C), and guanine (G) are four nucleic acid bases…

Q: What is the role of di-deoxy DNTPs in a Sanger sequencing reaction? Please select the answer that…

A: Sanger sequencing is a method which helps in termination of chain and determining the nucleotide…

Q: While studying the structure of a small gene that was recently sequenced during the Human Genome…

A: The rule in the case of DNA indicating that there is always equality in quantity between the bases A…

Q: Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules,…

A: DNA (Deoxyribonucleic acid) and RNA (Ribonucleic acid) are two examples of nucleic acids. DNA and…

Q: Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change…

A: Mutations are the abrupt changes in the DNA sequences due to wrong reading of the DNA polymerase…

Q: In a Sanger DNA sequencing reaction (dideoxy method) you use the primer 5′-GCATATA-3′ to sequence a…

A: Sequencing of DNA refers to the biochemical methods for determining the order of the nucleotide…

Q: 1000bg 800b 500bd 300bd 100bg Identify the sizes of the DNA bands in the agarose gel above using the…

A: Agarose gel electrophoresis is a separation technique mostly used for DNA molecules. Where a sample…

Q: What is the complete base composition of a double-stranded eukaryotic DNA that contains 22% guanine?…

A: Chromosomes in a eukaryotic cell are composed of DNA and protein. DNA in eukaryotes is double…

Q: You are working in a biotechnology lab and are analyzing DNA. You obtain a sample of a short…

A: DNA is present inside the nucleus and consists of instructions for the synthesis of protein. The…

Q: A linear piece of DNA that is 30 kb long is first cut with BamHI, then with HpaII, and, finally,…

A: The restriction enzyme is a protein and it recognizes a specific sequence of short nucleotides and…

Q: What was the function of each solution or step in the DNA purification protocol? The following…

A: Deoxyribonucleic acid extraction is the isolation and purification of DNA from sample using a…

Q: Given the following mismatch (highlighted in red), which base will be replaced after mismatch repair…

A: Normal metabolic activities and environmental exposure can cause DNA damage. DNA damage in human…

Q: You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To…

A: In PCR, forward and reverse primers are to be added. PCR involves denaturation, annealing and…

Q: Your PhD thesis advisor has given you the task of preparing a human genomic DNA library. 3a. How…

A: The length of the human genome is approximately 3.2 billion bases with genes of 20000-25000 protein…

Q: You have received a dehydrated sample of DNA primer at a concentration of 19.9 microM. what volume…

A: Asked : Volume (in microL) of buffer to get a solution of 100nM primer from 19.9 microM dehydrated 1…

Q: The following is the base sequence of DNA that codes for first eight amino acids of the β chain of…

A: 1. Each amino acid corresponds to a codon and each codon is made up of sequence of three nucleotide…

Q: Calculate the net force that thymine exerts on adenine. To keep the calculations fairly simple, yet…

A: In DNA (deoxyribonucleic acid), the base pairing occurs according to Chargaff’s base-pairing rule.…

Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…

A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…

Q: Calculate the approximate number of: Base pairs in 6 helical turns of B - DNA (based on the values…

A: DNA is a double helical structured nucleotide that contains combinations of base pairs. It consists…

Q: That's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment),…

A: Agarose gel electrophoresis is mainly used for nucleic acid separation due to its large pore size…

Q: The sequence of the 15 bp fragment from the previous problem is repeated below: 5' TCTGAATTCCGTAGA…

A: DNA is a double-stranded molecule that is made of several nitrogen base pairs. The nitrogen base of…

Q: A 1% by weight agarose gel is typically used in agarose gel electrophoresis. If you used a 2%…

A: During agarose gel electrophoresis, an agarose solution is prepared, it is cooled to prepare a gel,…

Q: Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be…

A: A primer may be a brief single-stranded nucleic acid utilized by all living living beings within the…

Q: Using the straight-chain sugar convention where the vertical lines represent sugars and the…

A: DNA is the genetic material in all living organisms and it is made up of thymine, adenine, guanine,…

Q: DNA renaturation curves occasionally show three distinct phases of renaturation. In this graph, DNA…

A: A denatured DNA can form a complementary base pairing with the complementary strand to form a DNA…

Q: If A represents 40% of the nucleotides in a particular piece of double stranded DNA, how often will…

A: As per Chargaff's rule, Amount of adenine = amount of thymine Amount of guanine = amount of cytosine

Q: A closed circular duplex DNA has a 100-bp segment of alternating C and G residues. On transfer to a…

A: B-DNA IS BIOLOGICALLY THE MOST COMMON –RIGHT-HANDED (20 ANGSTROM (A) DIAMETER) –COMPLEMENTARY…

Q: 3a)ClustalX software was used to perform multiple sequence alignment of the following five Nco…

A: Some frequently performed analysis via bioinformatics are DNA sequence analysis, amino acid…

Q: Following formation of a double-stranded break, enzymes process the dsDNA end to form…

A: DNA end resection is a key process in the cellular response to DNA double-strand break damage that…

Q: A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: Determine which primer pair is the best choice. • Explain why the other primers are not good…

A: A brief DNA or RNA sequence serves as the template and controls the production of a complementary…

Q: The base analog 5-bromouracil (5BU), which sterically resembles thymine, more readily undergoes…

A: Base analogs are the purines and pyrimidines that are similar in structure to the normal DNA bases.…

Q: Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using…

A: First a coding strand forms its complementary template strand during replication. Then m RNA is…

Q: (a) What two enthalpic factors stabilize DNA in double-helical form at lowtemperature?(b) What…

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…

Q: By average, how many Sau3A (5’GATC3’) sites are there in a 10 kd DNA molecule? (1/4)^6 * 10,000 =…

A: Answer :- For the first question, the restriction site for the enzyme Sau3a is composed of four…

Q: Assume complete digestion of a single linear piece of DNA digested (cut) with EcoRI and Hindill.…

A: A plasmid is a single-stranded, circular DNA molecule that is different from the chromosomal DNA of…

Q: A batch of this DNA is first fully digested by HpaI alone, then another batch is fully digested by…

A: The restriction enzymes clean the nucleotide fragment at specific sides called the restriction…

Q: Below is a sequence of DNA.…

A: Amino acids are the building blocks of proteins. The building blocks of life are amino acids and…

Q: As shown, five DnaA boxes are found within the origin of replication in E. coli. Take a look at…

A: E.coli. is a key model organism and has been used in so many research studies involving molecular…

Q: Are the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and…

A: A base is nitrogen containing heterocyclic compound which, is found in DNA and RNA. There are…

Q: A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is…

A: The given ssDNA would serve as a template strand for the synthesis of a complementary strand to form…

Q: All the DNA extraction protocols suggest adding salts to the extraction buffer. What is the role of…

A: * Dna extraction can be done in following steps Breaking cells to release the DNA Separating DNA…

Q: . A closed circular supercoiled DNA is relaxed by treatment with topoisomerase. No matter how much…

A: DNA topoisomerases are enzymes that relieve the topological strains in the DNA by creating single or…

Q: Base analysis of DNA from maize (corn) shows it to have 23 mole percent cytosine (moles per 100…

A: Gene is the basis of all living system as it consists of the hereditary information of the organism…

Q: What are the monomers that makeup a nucleic acid and what are the monomers composed of? What type of…

A: Biomolecules are organic compounds found in living organisms. All living organism will have these…

Q: A student is running gels to sequence a DNA fragment as below. In addition to running four…

A: Sanger's sequencing method. It is a method based on DNA synthesis. In normal DNA synthesis,…

Q: In order to determine the purity of a DNA sample. spectrophotometry can be carried out at _______ to…

A: DNA yield and purity is measured by absorbance. Absorbance is measured by spectrophotometer.

Q: Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using…

A: NOTE-"As per our honor code, we are authorized to answer only one question at a moment. As you have…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

100%

Group of answer choices

256 bases

12 bases

40 bases

16 bases

none of these

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A closed circular duplex DNA has a 100-bp segment of alternating C and G residues. On transfer to a high salt solution, the segment undergoes a transition from the B conformation to the Z conformation. What is the change in its linking number, writhing number, and twist?
A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?
in the DNA of certain bacterial cells, 13% of the nucleotides are adenine. What are the percentages of the other nucleotides?
Draw the structure of the following DNA sequence (5’-AG-3’) hydrogen bonded through Watson-Crick base pairing to the complementary PNA sequence (Cterminus-TC-Nterminus). Make sure to include both the sugar phosphate backbone of your DNA sequence, as well as the peptide backbone of your PNA sequence. DNA: 5’-AG-3’ PNA: (C)-TC-(N)
Base analysis of DNA from maize (corn) shows it to have 23 mole percent cytosine (moles per 100 moles total nucleotide). What are the percentages of the other three bases?
The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?
The base analog 5-bromouracil (5BU), which sterically resembles thymine, more readily undergoes tautomerization from its keto form to its enol form than does thymine. 5BU can be incorporated into newly synthesized DNA when it pairs with adenine on the template strand. However, the enol form of 5BU pairs with guanine rather than adenine. (a) Draw the 5BU · G base pair. (b) What type of mutation results?
The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.
Given the following mismatch (highlighted in red), which base will be replaced after mismatch repair occurs? Mutant sequence (CH3 = methyl): CH3 I 5'-GATCTCAGGC-3' 3;-CTAGAGGCCG-5' a. G b. A
Design a pair of primers to amplify the entire length of the following 45 base pair sequence.Make each primer 14 bases long. Write the sequences of the primers in 5' to 3' order.(Hint: It will help for you to write out BOTH strands of the DNA sequence listed below.5'-GATGCCCGTTGGATAAATTGGGCGTCTAGAATCGGTCACACTTAG-3'
If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?
What is the complete base composition of a double-stranded eukaryotic DNA that contains 22% guanine? Why is it necessary to specify that the DNA is double-stranded?