. A closed circular supercoiled DNA is relaxed by treatment with topoisomerase. No matter how much enzyme is used, or how long the experiment is run, the experimenter always finds a gel elec- trophoresis pattern indicating some DNA with one, two, and three superhelical turns in addition to the relaxed (nicked) circle (see fig- ure). Suggest an explanation for this observation. Nicked circle +
Q: describe the normal role of the component, and choose from the selection the most direct effect of…
A: Mutations are the defective change in DNA. Mutations basically changes the base pair sequence of DNA…
Q: Suppose that you wish to make a sample of DNA duplex highly radioactive to use as a DNA probe. You…
A: Ionizing radiation direct affects DNA structure by inducing DNA breaks, individually, DSBs.…
Q: A) If one of the primers has a point mutation distinct from the template what is the percentage of…
A: PCR or polymerase chain reaction is a technique which is used in amplification of DNA or produce…
Q: How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one…
A: Restriction endonuclease is defined as an enzyme responsible for cleaving DNA into small fragments…
Q: In a Sanger DNA sequencing reaction (dideoxy method) you use the primer 5′-GCATATA-3′ to sequence a…
A: Sequencing of DNA refers to the biochemical methods for determining the order of the nucleotide…
Q: snip
A: The study of how temperature affects the nucleic acid structure of double-stranded DNA (dsDNA) is…
Q: Biochemistry: Site-directed mutagenesis, in which individual amino acid residues are replaced with…
A: Enzyme activity is used to assess the catalytic activity of an enzyme. One enzyme unit (U) is the…
Q: Supercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more…
A: DNA is supercoiled structure which is present inside the nucleus The coiling of Dna is done by the…
Q: ing the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing…
A: DNA is a double stranded biomolecule. The DNA is usually digested by endonucleases and exonucleases…
Q: 1a) When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per…
A: Sanger sequencing, also called the “chain termination method”, to determine the nucleotide sequence…
Q: List and describe the function of the ten subunits constituting DNA polymerase III. Distinguish…
A: Introduction DNA pol III is the primary enzyme which leads the DNA replication system. It is a…
Q: (RE) recognition sites marked with arrows. A spontaneous mutation (insertion) occurred in DNA sample…
A: Answer ::
Q: Just question 28
A: RNA viruses have either single- or double-stranded RNA as the genetic material, either in a single…
Q: 100 50 104 1 10 104 Cot DNA renaturation curves occasionally show three distinct phases of…
A: A single stranded DNA binds to its complementary strand to reform double stranded DNA is called…
Q: Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is added to the growing DNA…
A: Point mutation : It occurs as result of replacement of one nucleotide by other. point mutation bring…
Q: primase The enzyme synthesizes the RNA primers required for DNA replication. Why are the RNA primers…
A: DNA has a double stranded structure. During DNA replication, the DNA double helix unwinds & each…
Q: 100 50 10 1 10 10 Cot DNA renaturation curves occasionally show three distinct phases of rena-…
A: The denatured DNA can reformulate hydrogen bonds between complementary single strand, making it…
Q: Calculate the expected number of times that a given 8-base-pair DNA site should be present in the E.…
A: A bacterial genomic DNA resides inside cells in a highly condensed and functionally organized form…
Q: Suppose that a single DNA base change of an A to a T occurs and is copied during replication. Is…
A: DNA replication is necessary for the survival of the organism.
Q: a Given the following restriction map of a cloned 10 kb piece of DNA, what size fragments would you…
A: The process of fragmenting deoxyribonucleic acid strands with specific enzymes is restriction…
Q: Proofreads each nucleotide its template as soon as it is added to the growing strand. A) DNA Ligase…
A: DNA is a genetic material that uses transcription and translation to transfer genetic information to…
Q: DNA polymerase I, DNA ligase, and topoisomerase I catalyze the formation of phosphodiester bonds.…
A: The DNA replication is a semi-conservative mechanism in which the new complementary strand is…
Q: Which statement below explains the trick in sanger sequencing that produces fluorescently labeled…
A: DNA sequencing Sequencing of DNA is a method to know the order of nucleotide bases in a DNA strand.
Q: The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If…
A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…
Q: Choose the false statement: O Using the experimental design from Griffith's experiments on rough and…
A: The false statement is option b)- The term 'gene' was coined by Griffith to explain what was being…
Q: Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between…
A: Polymerase chain reaction used to make thousands of copies of DNA from very small amount of the DNA…
Q: Explain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA…
A: Introduction DNA is an organic chemical that contains genetic information as well as instructions…
Q: For your 25ul ligation reaction: You need to add 160ng of your digested insert DNA (which is at a…
A: Given: Total volume - 25ul. The DNA need to be added is 160 ng. One ul contains 160 ng of digested…
Q: 3. You isolate DNA from 1 ml of a suspension of E. coli cells using the procedure outlined in your…
A: a. 10 μl DNA solution was added to 490 μl buffer to make a total volume of 500 μl. Therefore the…
Q: . After Okazaki's proposal of discontinuous DNA chain growth, there was much controversy about…
A: DNA synthesis/replication occurs in 5' to 3' direction on both the strand. The leading strand…
Q: Mutation of subunit epsilon (ɛ) of DNA polymerase II will result in an E. coli strain that has a…
A: Question -Mutation of subunit epsilon (ε ) of DNA polymerase lll will result in an E. coli strain…
Q: "Complementary DNA (cDNA) libraries offer certain advantages over genomic libraries". Explain how ?
A: Introduction The cDNA library is a collection of mRNA segments cloned into independent vector…
Q: Single-strand binding proteins keep the two parental strands of DNA separated from each other until…
A: Deoxyribonucleic acid or DNA is the genetic material that is passed on from the parents to the…
Q: Describe three examples of specific recombinases that have been discussed in this class. Include a…
A: Site specific recombination is process by which homologous chromosomes Cross over. The enzymes helps…
Q: 7. You are preparing a library to sequence two samples, one from a WS and one from a FS, via…
A: Introduction An aligned read is that sequence which has been aligned to a common reference genome.…
Q: la: Several factors (including agarose gel concentration, time and current) affect migration of DNA…
A: Disclaimer: As per the Bartleby guidelines, I am answering the first three questions. Please ask…
Q: describe the normal role of the component, and choose from the selection the most direct effect of…
A: Introduction :- DNA is the genetic material of the cell . It stores all the hereditary information (…
Q: In large-genome sequencing projects, the initial data usually reveal gaps where no sequence…
A: Primer walking or directed sequencing is a sequencing method for sequencing DNA fragments that are…
Q: HgaI recognizes a specific 5 bp sequence. How frequently would you expect a specific 5 bp sequence…
A: Restriction enzymes are the molecular scissors and are used to cut at a specific site. These are…
Q: Compare the DNA binding modes of minor groove binding, intercalating, and crosslinking agents and…
A: The new drugs used in most cancer diseases and other diseases are DNA intercalating and minor groove…
Q: describe the normal role of the component, and choose from the selection the most direct effect of…
A: Introduction :- DNA is synthesized through the process of DNA replication, during the S phase of…
Q: The 3' exonuclease activity of E. coli DNA polymerase I was found to show no discrimination between…
A: DNA polymerase enzyme is involved in the synthesis of DNA. The nucleotides gets added one by one to…
Q: DnaA proteins bind to repeated binding sites on the DNA double helix, helping to recruit the…
A: Replication is the process by which a double-stranded DNA molecule is copied to produce two…
Q: Describe the normal role of the component, and choose from the selection the most direct effect of…
A: Introduction :- DNA replication is the process of Synthesis of new DNA molecule, using old DNA as…
Step by step
Solved in 3 steps
- 1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…In experiments using polymerase chain reactions (PCR), it is often more difficult to amplifythrough regions of DNA that are high in GC content versus those regions that are either lower inGC content or are AT-rich. Based on your knowledge of DNA structure, explain why.That's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment), please discuss the results and label and name the image to illustrate the answer? - Marker band sizes in gel: From top (well side) to bottom the bands have the following size in base-pair/bp- 6751,3652,2827,1568,1118,825,630
- In Noll’s experiment , explain where DNase I cuts the DNA. Why were the bands on the gel in multiples of 200 bp at lower DNase I concentrations?Biochemistry: Site-directed mutagenesis, in which individual amino acid residues are replaced with others, is a powerful method to study enzyme mechanisms. In experiments with particular enzyme, various lysine residues were replaced with aspartate, yielding the results summarized in the table below: Enzyme Form: Enzyme Activity (U/mg) Native enzyme: 1,000 U/mg Recombinant Lys 21 to Asp 21: 970 U/mg Recombinant Lys 86 to Asp 86: 100 U/mg Recombinant Lys 101 to Asp 101: 970 U/mg a. What might be inferred about the role of Lys 21, 86, and 101 in the catalytic mechanism of this enzyme? b. Discuss where within the enzyme one might find Lys 21 and 101. Are these residues likely to be evolutionary conserved in this enzyme? Explain c. Is Lys position 86 likely to be evolutionary conserved? ExplainSuppose that a replicative DNA polymerase had its 3′ exonuclease site 1.5 nm from the polymerase site, rather than the 3.0 nm seen in Klenow fragment. How would this change affect the fidelity of the enzyme? Why? Describe an additional change that could give this enzyme the same fidelity as Klenow fragment while retaining the 1.5-nm inter-site distance.
- Homologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli leads to the formation of regions of heteroduplex DNA. By definition, such regions contain mismatched bases. Why doesn’t the mismatch repair system of E. coli eliminate these mismatches?Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.Although DNA polymerases require both a template and a primer, the following single-stranded polynucleotide was found to serve as a substrate for DNA polymerase in the absence of any additional DNA.3′ HO-ATGGGCTCATAGCCGGAGCCCTAACCGTAGACCACGAATAGCATTAGG-p 5′What is the structure of the product of this reaction?
- Can you please help with 1a please picture with 1 graph is for question 1a) picture with 4 graphs is for question 1b) 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp fragments and put it through density gradient equilibrium centrifugation, you will find that all the DNA bands at the same place in the gradient, and if you graph the distribution of DNA fragments in the gradient you will get a single peak (see below). If you perform the same experiment with binturong DNA, you will find that a small fraction of the DNA fragments band separately in the gradient (at a different density) and give rise to a small "satellite" peak on a graph of the distribution of DNA fragments in the gradient (see below). Why do these two DNA samples give different results, when they're both 50% G-C? 1b) If you denatured the random 1000 bp fragments of binturong DNA that you produced in question 1a by heating them to 95ºC, and then cooled them down to 60ºC and…The enzymes ECORI and HINDIII are called "compatible" enzymes. DNA cut with these enzymes can be ligated together, but it will usually not be able to be recut with the original enzymes. If that procedure were carried out, what would the DNA sequence be?The temperature at which a DNA sample denatures can be used to estimate the proportion of its nucleotide pairsthat are G- C. What would be the basis for this determination, and what would a high denaturation temperature for aDNA sample indicate?