How would the deletion of the Shine–Dalgarno sequence affect a bacterial mRNA?

Q: So the spliceosome is a structure that allows RNA splicing to occur, expelling the introns. Does…

A: spliceosome is a RNP complex found in eukaryotic Nucleus and is responsible for removal of introns…

Q: The steady state level of a mRNA for a gene is affected by the following mechanism(s)

A: Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that is linked to genetic…

Q: When an intron is undergoing the first step in splicing, where is the first breakage of the…

A: Gene splicing is a post translational process, which is a characteristic of eukaryotes and it…

Q: What function do the 5' cap and the poly-A tail serve on a eukaryotic mRNA?

A: DNA is a long polymer of deoxyribonucleotides. It is an acidic substance present in the nucleus,…

Q: What is an Okazaki fragment, and how are they later “glued” together?

A: In the semi discontinuous mode of replication when DNA unwinds , one strand is synthesized…

Q: What mRNA is most obviously essential in coding proteins, list and describe two classes of…

A: RNA is an intermediate between DNA and proteins.

Q: the translate on the mRNA in 5'AAA-AAA-AAA-AAA-AAA3' is?

A: Introduction :- In molecular biology , different processes of gene expression is studied , these…

Q: A gene contains eight sites where alternativesplicing is possible. Assuming that the splicing…

A: according to the question, A gene contains eight sites where alternative splicing is possible:

Q: Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: What is the molecular weight of an mRNA that codes for the protein of molecular weight 75000KD?…

A: The translation is a process in which protein gets synthesized from mRNA template. It occurs in 3…

Q: For each of the following initiation factors, how would eukaryoticinitiation of translation be…

A: Initiation factors are a kind of proteins, which bind to the smaller subunit of the ribosome. This…

Q: What is the mRNA for a Coding Strand of TAT?

A:

Q: Why can't the RNA leader form the terminator in the 2-3 stem loop configuration and what happens as…

A: The question is the part of the tryptophan operon and attenuation.  Attenuation is a mechanism for…

Q: What would be the likely effect of a mutation that prevents s from dissociating from the RNA…

A: RNA polymerase or DNA dependent RNA polymerase is an enzyme that synthesizes RNA from the template…

Q: How is the poly(A) tail added to pre-mRNA? What is the purpose of the poly(A) tail?

A: Transcription is the first of several steps of DNA based gene expression in which a particular…

Q: What are the steps involved in the processing of eukaryotic pre-MRNA? why is this process important?

A: Eukaryotic pre-mRNA undergoes extensive processing where is pre - tRNA, pre rRNA in both prokaryotes…

Q: How do the stop codons UAA, UAG, and UGA know to form? What if a protein stops synthesizing too…

A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid. The…

Q: What features do mature eukaryotic mRNA molecules have that bacterial mRNAs lack?

A: The process associated with the formation of mRNA (messenger ribonucleic acid) from DNA…

Q: What would be the consequences if a mutation removed the rut site from this RNA molecule?

A: Mutation is an abrupt change in the DNA sequence and nucleotide base pairs.  Mutation is caused by…

Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…

A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…

Q: How do the wobble rules affect the total number of different tRNAs that are needed to carry out…

A: The pairing of tRNA anticodon with mRNA codon lead from the 5’ end of codon. The first 2 position…

Q: Explain how eukaryotic mRNAs are modified to have a cap and a tail.

A: Biomolecules are the compounds that are necessary for different biological processes occurring in a…

Q: Does RNA polymerase stop transcribing when it comes to a stop codon? Explain

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: What role does the poly(A) tail play in mRNA function?

A: Polyadenylation is a process in which poly (A) tail is added to the 3' end of the newly synthesized…

Q: Why Eukaryotic mRNAs Require MoreProcessing than Prokaryotic mRNAs?

A: The DNA is the genetic material that is passed from one generation to the next generation. It is…

Q: How many possible mRNAs could be derived from a gene with three exons (exon 1, exon 2, and exon 3)?…

A: Transcription is a process in which one strand of DNA known as template strand is known as converted…

Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the…

A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and…

Q: What are the three primary regions of mRNA sequences in bacterial cells?

A: DNA carries the genetic information for the protein production in the body. DNA decoded into mRNA,…

Q: How Can a Sequence Logo Be Used to Identify RibosomeBinding Sites on Bacterial mRNAs?

A: Introduction  Bioinformatic is the advanced and recent branch of biology which utilizes computers…

Q: How are specific mRNAs targeted for decay by deadenylation-dependent or -independent decay?

A: mRNA degradation is a mechanism that eliminates mRNA that is no longer needed in the cell or has…

Q: How would a mutation in the poly(A)-binding protein gene affect translation? How would an electron…

A: Restriction digestion analysis of any band that is subjected to the process of reverse transcription…

Q: If the mRNA produced had the sequence ACGCGU, What would be the tRNA anticodon sequence?

A: mRNA is a messenger RNA that is synthesized from the DNA by the process called transcription. The…

Q: What is the function of the Shine–Dalgarno consensus sequence?

A: Prokaryotes are the organisms that lack the cell nucleus and membrane-bound organelles. They have…

Q: What polypeptide product would you expect from apoly-G mRNA that is 30 nucleotides long?

A: Introduction:- The mRNA is composed of nucleotides .A series of 3 bases is a codon.Each codon codes…

Q: The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the…

A: Answer- According to the genetic code, all the 20 amino acids are coded by 64 set codons of…

Q: How do eukaryotic cells ensure the start codon of the mRNA is positioned properly during translation…

A: The initiation of protein synthesis consists in the recruitment of a ribosome initiator tRNA complex…

Q: Explain why a minimum of 32 tRNAs are required to translate the “standard” genetic code.

A: Genetic code is considered degenerate, where several amino acids are encoded by more than just one…

Q: Bacterial messenger RNAs usually contain many AUG codons. How does the ribosome identify the AUG…

A: AUG codon codes for methionine. It is the initiation codon that helps in initiating the translation…

Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. What is the…

A: The coding sequence of the Gene F and G are given as                                        5'…

Q: What are the steps involved in the processing of eukaryotic pre-mRNA? Why is this process important?

A: In humans or in eukaryotes, the newly made RNA transcript is not yet ready to go and is called as…

Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…

A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…

Q: What is the first anticodon recruited to an mRNA?

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: Why are transfer RNAs important in translation? Dogenes for tRNAs have promoters, and are…

A: Ribonucleic acid (RNA) are polymeric organic molecules, which are essential for carrying out various…

Q: What is the complementarity rule that governs the synthesis of an RNA molecule during transcription?…

A: Complementarity is a property according to which two DNA or RNA strands bind with each other or new…

Q: What is the minimum length of time required for the synthesis by E. coli polymerase of an mRNA…

A: The transcription of an mRNA encoding a 100-kDa protein by E. coli polymerase is known as…

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: Translation is the process of synthesis of protein from an mRNA. It requires two types of RNAs…

Q: Consider the wobble rules listed in Table 15.2. Which of the following mRNA codons will bind to the…

A: Protein translation is the process of molecular biology in which the mRNA synthesized by the process…

Q: An RNA sequece includes 15 codons. How amny animo acids does this sequence encode?

A: The central dogma was given to depict the flow of genetic information. It includes various…

Q: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino acid…

A: mRNA(messenger RNA) carries the genetic information copied from DNA in the form of a series of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.