Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino acid structure produced? What is the primary structure if a mutation changes CUU to CCU?
Q: At what pH does a lysine solution exhibit the highest buffering capacity? (Lysine pKas: pk1 = 2.2, p...
A: Buffer has the capability of resisting pH changes in a solution even when small amount of acid or ba...
Q: After Drosophila DNA has been treated with a restrictionenzyme, the fragments are inserted into plas...
A: Cloning is a particular technique scientists use to make exact genetic copies of living organisms. D...
Q: Levels of RNA structure/folding include a Secondary and Tertiary b Primary and Secondary ...
A: Ribonucleic acid (RNA) is a single-stranded nucleic acid that takes part in protein synthesis. The b...
Q: Explain how gel filtration chromatography works. What type of gel will you used when the protein siz...
A: Chromatography is a process for separating components of a mixture based on their differential parti...
Q: (a) A solution containing these five proteins was adjusted to pH 7.0 and then applied to a SIZE-EXCL...
A: Chromatography is a method of separation of specific compounds from the mixture of compounds. This c...
Q: raw the structure and give the name of the pentapeptide GRAND. Encircle all peptide bonds as well
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: 1. What is the physiologic function of pigments in plants?
A: Pigments are compounds that absorb specific wavelengths and reflect away, the other. Plant parts are...
Q: give one example of charbohydrate being used as information molecule, explain
A: A carbohydrate is a biomolecule made up of carbon (C), hydrogen (H), and oxygen (O) atoms, generall...
Q: Given the following reaction, identify the class and subclass of the enzyme involved. CH2OH C=O H-C-...
A: Enzymes catalyse the reaction either by making or breaking the bond. They might form double bonds or...
Q: Why are carbohydrates the body's preferred source of energy? Because they ... * A. are expensive t...
A: Carbohydrates considered as sugar molecules. Along with other proteins and fats, carbohydrates are a...
Q: A pyrimidine(s) with a H-bond acceptor its middle position is/are a Cytosine b Uracil c ...
A: Hydrogen bond donor is the atom that do not provide a hydrogen atom for hydrogen bonding. They mig...
Q: If you have to prepare 4 nM solution of human IgG ( immunoglobuline) which has molecular mass of 150...
A: The number of moles of a solute present in one liter of the solution is called the molarity of that ...
Q: Dopamine, norepinephrine and epinephrine are collectively called catecholamines. Which of the follow...
A: Catecholamines are group of hormones made by adrenal glands and its is secreted the chromaffin cells...
Q: 50 Which best describes the role of FADH2 in aerobic metabolism? O FADH2 is a proton shuttle and tra...
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic p...
Q: What are the main ingredients in the manufacture of mayonnaise? Explain the role of each component.
A: Mayonnaise is a food ingredient that is an emulsion of oil, egg yolk, acid and either vinegar or lem...
Q: the different individuals involved in a clinical laboratory (their job specification -qualification,...
A: JOB SPECIFICATION Laboratory Director QUALIFICATION and TRAINING Doctoral degree (e.g., MD or ...
Q: What is the importance of central dogma
A: DNA contains genetic information in the form of nucleotide sequences. DNA is composed of four differ...
Q: ACTIVITY 7.1.2 Write the structural formula of dATP, DTTP, DCTP, dGTP, UTP, and give the complete na...
A: Introduction: Deoxyribonucleic acid is made up of subunits called nucleotides. Each nucleotide cons...
Q: GIVEN: Centrifuge A: rotor radius - 5 cm; max. speed - 4,000 xg Centrifuge B: rotor radius - 7 cm; m...
A: Centrifuge is a device used for separating molecules having different densities. The process is call...
Q: Which of the following is TRUE? Select one: a. The disulfide bridges formed by oxidation of the sulf...
A: The tertiary structure of the proteins is due to various interactions between the side chains in the...
Q: Show the relationship between lipids, nucleic acids, proteins, and carbohydrates including the conne...
A: A biomolecule, also called a biological molecule, is a chemical compound found in living organisms. ...
Q: 6 Concanavalin (ConA) is a 25.5KDa protein with pI of 4.7 and optical absorbance (A 0.1% 289) of 1.1...
A: Proteins are polymers of amino acids with specific molecular weight and pI (isoelectric point, pH at...
Q: Propose a reasonable pathway to degrade the following amino acid to core metabolic intermediates. Me...
A: In the given amino acid structure, there is additional amino group in sidechain and structure is sim...
Q: A patient comes in with vaginal discharge and itching. What do you expect to see in the microscope i...
A: Introduction: Yeast are eukaryotic microorganisms that are classified in the kingdom Fungi. It grow...
Q: Disulfide bridges are limited in that only one particular amino acid can form these types of interac...
A: Disulfide bonds are a second post-translational alteration found only in ER proteins. The presence o...
Q: Use of Microbes for Improving Food Safety and Quality Yeast Probiotics Please have a whole paragrap...
A: An eaten probiotic is a live microorganism that has a favourable effect on the prevention and treatm...
Q: Write the structure formula, three-letter and one-letter abbreviation for each essential amino acid ...
A: There are twenty naturally occurring amino acids that form proteins in biological systems.
Q: Given that the reduction potential Eo'= -320, +10, +816, and +50mV for NAD+, fumarate, 02 and G3P DH...
A: NAD+ oxidises glyceraldehyde 3-phosphate, incorporating inorganic phosphate (Pi) to create 1,3-bisph...
Q: Which of the following statements concerning structural characteristics of bile acids is CORRECT? * ...
A: Bile acids are a collection of acidic steroid molecular entities with unusual physical, chemical, an...
Q: Increase the amount of substrate present. Increase the amount of enzyme present. Decreas...
A:
Q: Which of the followingdescribe superior properties of enzymes (biological catalysts) over traditiona...
A: Enzymes are biocatalysts that are protein in nature. They Enzymes present a the particular substrate...
Q: It is becoming possible for molecular biologists to synthesizealmost any protein desired. Suppose yo...
A: Comparative physiology is a branch of physiology that investigates and exploits the wide range of fu...
Q: What is the pathway called froman alternative pathway branching from glycolysis that is used when ox...
A: Glycolysis is a catabolic pathway in which glucose will be oxidized to 2 molecules of pyruvate. Pyru...
Q: 3. Draw out the first 3 enzymatic reactions of the PPP, including listing names of S, P, coenzymes, ...
A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we are answerin...
Q: What is Circular Dichroism? Discuss its theory and applications.
A: Circular dichroism is a form of light absorption spectroscopy. This method was first described by Bi...
Q: 3) Now put this information to use.... suggest a synthesis of 13b, a peptidomimetic inhibitor of the...
A: Compound 13b is a SARS-CoV2 main protease inhibitor and is derivative of α-ketoamide inhibitor. Foll...
Q: What are the types of genes and their functions ?
A: Introduction: Gene is a basic unit of hereditary information and it determines the inherited charact...
Q: How much ATP and CO2 can be derived from 500 g of lactose?
A: Lactose is a sugar that is found in milk. Lactase is an enzyme that helps our systems absorb sugar b...
Q: Given the active site and reaction mechanism below, what is the mechanism of irreversible inhibition...
A: The given example is uncompetitive inhibition. Uncompetitive inhibition, also known as anti-competit...
Q: Given a tripeptide Cys-His-Lys, Cys: Pk1 = 1.71; Pk2 = 10.78; PkR = 8.33 His: Pk1 = 1.82...
A: Hi. Thank you for the question, As per the honor code, we are allowed to answer three sub-parts at ...
Q: Suppose you have a solution of 0.1 M H2CO3 and 0.1 M NaHCO3. Which of the following reactions takes ...
A: A buffer solution is composed of a weak acid and its conjugate base. A buffer solution resists the c...
Q: Assessing the efficacy of glucosamine and chondroitin sulfate for arthritis pain Treatment with...
A: Many patients with arthritis, particularly osteoarthritis, utilise vitamins in their diet to relieve...
Q: Ethidium Bromide is a chemical reagent that has been used to detect the presence of nucleic acids. I...
A: Nucleic acids are of two types : DNA and RNA. DNA refers to Deoxyribonucleic acid. It is genetic mat...
Q: CH,OH Он ÓH ÓH
A: The cyclic forms of carbohydrates can exist in different configuration based on the position of the ...
Q: A mixture containing arginine, glutamic acid and isoleucine was subjected to electrophoresis at pH 7...
A: Amino acids differ from each other on the basis of their side-chain properties. There are twenty sta...
Q: Just as all life shares a last universal common ancestor,all eukaryotes share a last eukaryotic comm...
A: The most recent common ancestor of all existing life on Earth, also known as the last universal comm...
Q: What type of mutation can we get if we use phones and laptops too much
A: Phones and laptops are widely used gadgets nowadays . These devices emit the harmful electro magneti...
Q: I. Kwashiorkor, also known as «cdematous malnutrition» because of its association with edema (fluid ...
A: Kwashiorkor or Edematous malnutrition: Kwashiorkor is a protein nutritional disorder associated with...
Q: How does protein form?
A: The Central dogma of molecular biology outlines the steps by which the information encoded in the DN...
Q: Draw the structure of the phenol derivatives
A: Introduction: Phenols are compounds in which the hydroxyl group is present in the benzene ring. It...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Discuss Concepts The normal form of a gene contains the nucleotide sequence: When this gene is transcribed, the result is the following mRNA molecule: In a mutated form of the gene, two extra base pairs (underlined) are inserted: What effect will this particular mutation have on the structure of the protein encoded in the gene?Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? Translation stalls after the initiation AUG codon is identified The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites The ribosome cannot interact with mRNAs tRNAs cannot exit the E site of the ribosome.
- Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. How many codons are represented in this oligonucleotide? If the second G were changed to a C, what would be the resulting amino acid?120. What is the nature of the molecule coded by each codon(triplet code) of mRNA? A.Peptide bond B.Protein C.Polypeptide D.Amino acid4. A mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide the amino acids specified by the mini mRNA. b) Label the two ends of the short peptide.
- Let’s practice making a strand of mRNA. Finish what we started: DNA: T-A-C-T-T-A-C-A-C-G-T-C-A-A-C-G-T-G-C-C-T-T-A-G-C-C-A-T-TmRNA: A-U-GGo ahead and write out the complementary strand of mRNA above30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide.5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands and what direction will the RNA polymerase travel to make the mRNA? Transcribe the DNA into mRNA (Include polarity)and translate the mRNA into a polypeptide chain (Include polarity)
- 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'90. If the mRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3' , then what is the corresponding tRNA anticodon sequence? A.5' - UAC - AAA - UUU - UCA - CCA- 3' B.3' - UAC - AAA - UUU - UCA - CCA- 5' C.5' - CCA - AAA - TTT - TCA - TAC - 3' D.3' - TAC - AAA - TTT - TCA - CCA- 5'Which amino acid sequence will be generated during translation from the following small mRNA: …CCC-AUG-UCU- UCG-UUA-UGA-UUG…? (Hint: Remember where translation starts and stops.) (a) Met-Glu-Arg-Arg-Glu-Leu (b) Met-Ser-Ser-Leu-Leu (c) Pro-Met-Ser-Ser-Leu-Leu (d) Pro-Met-Ser-Ser-Leu (e) Met-Ser-Ser-Leu
