Answered: Identify (circle the mutation in the…

Name: MutationsAdenosine triphosphate is an energy molecule found in cells
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: MutationsAdenosine triphosphate is an energy molecule found in cells and produced as a result of cellular respiration.Many enzymes are required for cellular respiration to produce an ATP molecule. The following is an original DNAsegment from a seque

Science

Biology

Identify (circle the mutation in the mutated sequence) and name the type of mutation that occurred.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 16P: Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins,...

See similar textbooks

Similar questions

Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
What type of mutation (missense, silent, and non-sense) was introduced in your sequence when G was substituted with C (Question C) ? Question C: Guanine nucleotide (G shown in red in the DNA sequence below) was substituted by C Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?)
Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.
⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?
Mustard gas is an extremely toxic substance that severelydamages lung tissue when inhaled in large amounts. In smallamounts, mustard gas is a mutagen and carcinogen. Considering that mustard gas is a bifunctional alkylating agent, explain how it mutates genes and impacts DNA replication.
Below are several DNA sequences that are mutated compared with the wild-type sequence. Eachis a section of a DNA molecule that has separated in preparation for transcription, so you are onlyseeing the template strand. For each mutated DNA sequence, translate and record the resultingamino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation:
A molecular researcher, Dr. Sidra Alkatini, is investigating the manifestation of a disorder in some of her lab mice models, which are lacking production of an important protein necessary for the cellular respiration pathway. The afflicted mice are short lived, and have perpetually low blood glucose levels, no matter how much food they are fed. Through sequencing, the following strand of DNA was produced:                    5’ TTC CAA TTA CGC CGC TAT ACG CGC ACC ATG TTA TCA TGT TGG TGG TAG 3’ Given your expertise in genetics, she contacts you, her BFF, to help her understand the sequence and its relation to the genetic disorder she is seeing. 1) What motif in this DNA sequence would serve as the RBS? a Essentially none; this is a eukaryotic sequence, so the RBS will be made up of the methylated G-cap! b CAAT! c ACCATGG! d TATA! 2) Do you notice anything unusual about this transcript? a YES! It is very short! b YES! It is…
A molecular researcher, Dr. Sidra Alkatini, is investigating the manifestation of a disorder in some of her lab mice models, which are lacking production of an important protein necessary for the cellular respiration pathway. The afflicted mice are short lived, and have perpetually low blood glucose levels, no matter how much food they are fed. Through sequencing, the following strand of DNA was produced:                    5’ TTC CAA TTA CGC CGC TAT ACG CGC ACC ATG TTA TCA TGT TGG TGG TAG 3’ Given your expertise in genetics, she contacts you, her BFF, to help her understand the sequence and its relation to the genetic disorder she is seeing. 1) Considering the entire DNA sequence shown above, specify the numbered codon that represents START. a Codon 10. b Codons 12-13. c Codon 9. d Codons 28-30. 2) Indicate three motifs that justify this as being a eukaryotic sequence. a CAAT, TATA, ACCATGG. b GACA, TATAAT, AAUAA.…
A molecular researcher, Dr. Sidra Alkatini, is investigating the manifestation of a disorder in some of her lab mice models, which are lacking production of an important protein necessary for the cellular respiration pathway. The afflicted mice are short lived, and have perpetually low blood glucose levels, no matter how much food they are fed. Through sequencing, the following strand of DNA was produced:                    5’ TTC CAA TTA CGC CGC TAT ACG CGC ACC ATG TTA TCA TGT TGG TGG TAG 3’ Given your expertise in genetics, she contacts you, her BFF, to help her understand the sequence and its relation to the genetic disorder she is seeing. 1) Now that you have seen the sequence and identified some of the major motifs it contains, what are going to tell Dr. Alkatini about in relation to the genetic disorder she is seeing? a “Listen, Doc, it is clear there is no STOP signal in the last codon place where it normally should be.” b “Listen, Doc, the fact…
Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differencesbetween the reaction catalyzed by the polymerase activity of DNA polymerase and the one catalyzed by ligase.
Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Guanine nucleotide (G shown in red below) was deleted from the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?)
In the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?