Name the disease occur due to defective Nonhomologous End Joining Repair.
Q: Is chromatin structure is altered in transcription? Explain
A: Solution- Chromatin- It is a thread like structure in nucleus. it's uncondensed molecules of DNA…
Q: A gene contains 30% thymine. What is the percentage of pyrimidines present in this segment? Explain.
A: Purines and pyrimidines are chemical molecules that play a role in the production of DNA and RNA and…
Q: Which region are untranslation region?
A: Translation: It is a process that converts the sequence of mRNA into amino acids during protein…
Q: What is thee tRNA anticodon for the first 5’-ACGAUC-3’?
A:
Q: Illustrate and give the normal sequence and the mutated sequence in Leigh's syndrome
A: A disease is a state of unhealthiness of the physical body, mind and social interaction. A disease…
Q: Describe the structure of nucleosome ( please keep it short as much as you can ).
A: A nucleosome is a basic structural unit of eukaryotic chromatin . It consists of approximately 150…
Q: What do you mean by Error-Prone Repair by Nonhomologous End Joining?
A: Non-homologous end joining (NHEJ) is a pathway that repairs double strand breaks in DNA. NHEJ is…
Q: AAUCCCAAU ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the…
A: Telomeres are the structures(caps) that are present at the end of the chromosomes, their fhbction is…
Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…
A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…
Q: The variation in the length of tandem repeat of microsatellite DNA has serious translational affects…
A: Microsatellite is a repetitive DNA sequence, in microsatellite some DNA motifs are repeated for so…
Q: Coding sequences in a post-transcriptionally modified eukaryotic transcript codes for _____. a.…
A: Coding sequence codes for functional protein products. Coding sequence codes for the functional…
Q: Which primer would be appropriate to amplify the top strand of the DNA molecule shown? 5'…
A: Polymerase chain reaction is a method widely being used to make multiple copies of the same DNA…
Q: define the term deletion loop
A: Chromosomes are thread-like structures that carry genetic information. Each chromosome consists of…
Q: Identify the type of mutation shown Original Sequence: GGC TAC ATG GAA Mutated Sequence: GGC TAA TGG…
A: Original Sequence: GGC TAC ATG GAAMutated Sequence: GGC TAA TGG AA
Q: What is the Evidence for a triplet code?
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3'…
A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…
Q: Identify (circle the mutation in the mutated sequence) and name the type of mutation that occurred.
A: # Here I have given solution of mutations only , please send next question related to genetics…
Q: n which condition does guanine-cytosine content inhibit the formation of right-handed DNA?
A: The guanine–cytosine content (or G+C content) is the percentage of nucleotides in a DNA or RNA…
Q: How many nucleotides would be necessary to code for 10 amino acids? Please help, I am lost!
A: Introduction :- DNA and RNA are made up of nucleotides, which are the basic building blocks of both.…
Q: 1. Explain how the synthesis of a DNA daughter strand growing toward a replication fork differs from…
A: DNA is deoxy ribonucleic acid that is present as a genetic material is living organism along with…
Q: define the term name as Missense mutations
A: sometimes a wrong nucleotide will be incorporated in the DNA. that can result in a type of mutation…
Q: Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING:…
A: The template strand is from 3` 5` and a coding strand of DNA is from 5` to 3`. The synthesis of m…
Q: With regard to the repair of double-strand breaks, what are the advantages and disadvantages of…
A: Double strand breaks is a mechanism to repair any break in the double stranded DNA molecule. The…
Q: During the resolution of the two Holliday junctions, how many strands of DNA in total are broken…
A: The Holliday junction is a branched cross-shaped nucleic acid structure. It is usually formed during…
Q: Dystrophin is mutated in the disease, causing a codon to change from GGA to UGA. What is the…
A: Dystrophin is a protein that helps keep muscle cells intact.
Q: What are endoribonucleases ?
A: Introduction: endoribonucleases work primarily in RNA processing and turnover.
Q: What is Barchyury protein? What is the structural aspects of DNA binding of Barchyury?
A: In 1927 brachyury mutation was first described in mice by adezhda Alexandrovna…
Q: Identify the following mutations and describe what the possible effect on the protein will be. 5'GAT…
A: 2.1 Mutations are defined as the variations or changes in the DNA which lead to variability in the…
Q: Why does the nucleus appear deep blue after staining with methylene blue? Is it possible that…
A: The dye methylene blue is a part of Leishman stain, which helps in staining acidic particles in the…
Q: What effect does the transposon have on the function of gene X in this figure?
A: Transposons are DNA segments that can migrate around in the genome of a single cell and take up…
Q: Would love a list of different types of nucleotide repeat disorders.
A: Nucleotide is a chemical structure which constitute together to form the genetic structure that is…
Q: Define the following terms:a. histonesb. heterochromatinc. euchromatind. intergenic sequencese.…
A: Ans: The terms given in the questions are all related to the genome of an eukaryotic organisms, they…
Q: In people, what is a common cause of thymine dimer formation and in what cell type(s) would it be…
A: Pyrimidine dimers are molecular lesions formed from thymine or cytosine bases in DNA by…
Q: Give 3 strand slippage and trinucleotide repeat disorder examples
A: DNA is the source of genetic information. It transfers genetic information from parents to…
Q: Explain how mismatch repair fixes incorrectly matched base pairs.
A: During DNA synthesis, most DNA polymerases use a process is called proofreading to double-check…
Q: Why might a protein precipitate when its tag is cleaved?
A: Precipitation of protein occurs because the change in pH or hydrophobicity results in the alteration…
Q: Explain the fate of transferred chromosomal DNA ifrecombination does not occur in the recipient…
A: Conjugation, transformation, and transduction are the three processes through which a cell can…
Q: What is the main difference between SPME and u- SPE?
A: Note - we answer one question at a time. Solid-phase micro-extraction is an extraction process for…
Q: If we have the following mutations, find the type of the mutation (silent or missense or nonsense?)…
A: In gametes, germline mutations occur. Some body cells may also be affected by somatic…
Q: Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to…
A: The messenger RNA (mRNA) sequence is given, and we are asked to determine the complementary…
Q: • Inversions alter the order, but not the number, of geneson a __________
A: The number and the structure of the chromosomes are maintained as such during the meiosis, however,…
Q: Why nonhomologous end-joining (NHEJ) is helpful ?
A: Non-homologous end joining (NHEJ) Is a repair process for double-strand DNA breaks. In contrast to…
Q: List three factors that do not foster a-helix formation.
A: Proteins are one of the major macromolecules that contain long chains of amino acids. The structure…
Q: Describe the function of telomere end-binding proteins
A: Introduction:The eukaryotic chromosomes are linear or rod-shaped having an end. during replication,…
Q: What happens in the absence of tryptophan in the 2-3 configuration?
A: Tryptophan is an amino acid needed for normal growth in infants and for the production and…
Q: Construct the following: 1. Adenosine 2. Deoxyguanosine 3. Thymidine 4. Deoxycytidine 5. 3’ TMP
A: Nucleic acid is macromolecule that consist of nucleotides and they act as building blocks of nucleic…
Q: Discuss the following mutations with reference to specific genetic disorders: i) Faulty DNA repair;…
A: Asked : Given mutations with respect to specific genetic disorders
Step by step
Solved in 2 steps
- Explain the kelch repeat domain in the problem is "in-line" or "plug-in" type domain.define the term deletion loopEcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .