Idris has successfully extracted enzymatic proteins from the fish viscera (intestines and stomach). After homogenization and centrifugation, he managed to pool the crude enzyme extract. He is characterizing the enzymes. Please help Idris by answering the following questions: The experiments I conducted showed that one of the enzymes was successful in degrading casein. (a). Which family of enzyme is it from? (b). What is the possible name of this enzyme and why?

Q: Identify the following by describing their functions: EF-G, EF-Tu, EF-Ts, EF-P, and peptidyl…

A: Elongation factors are a set of proteins that function at the ribosome, during  protein synthesis,…

Q: . Most bacterial mutants that require isoleucine for growth also require valine. Why? Which enzyme…

A: A mutation is a permanent alteration in the sequence of nitrogenous bases of a DNA molecule.

Q: How many of these strains of E. coli would have no ß-galactosidase activity?

A: Grouping functionally relevant genes together is a method used by bacteria to manage gene…

Q: what does the last number in the numeric designation of enzymes refer to?

A: The numeric designation of enzymes is a numerical classification system of enzymes, based on their…

Q: Given the fragment Ala-Lys-Tyr-Gly-Phe and Leu-Val-Ser-His-Cys-Arg, what is the expected result in…

A: Biuret test is a test used for detecting the presence of peptide bonds. Biuret Reagent is  formed by…

Q: What is the significance of the catalase enzyme in a bacterial cell?

A: Catalase is an enzyme that is involved in the catalysis of hydrogen peroxide decomposition. This…

Q: What do ‘H’, ‘in’, ‘d’ and ‘III’ refer to in the enzyme Hind III?

A: Restriction endonucleases, more generally known as restriction enzymes, are found in all organisms.…

Q: A Lineweaver-Burk plot generates a line with the following formula: y = 0.3x + 0.4. What is the Km…

A: Enzymes are the class of proteins that act as biological catalysts. They increase the pace of the…

Q: What are the modern techniques used to identify the active sites of an enzyme?

A: The part of the enzyme where the substrate binds is called the active site. An enzyme molecule has…

Q: What features distinguish enzymes that undergo allosteric control from those that obey…

A: Enzyme are the catalysts which increase the rate of reactions without affecting the equilibrium of…

Q: Five amino acids were subjected to reverse phase chromatography, and the following Rf values were…

A: Reverse phase chromatography is a technique for separation of non-polar molecules from polar…

Q: Lactose permease, a protein of E. coli, is composed of a singlepolypeptide that is 417 amino acids…

A: Translation is the process by which the protein is synthesized by reading the codons in mRNA. The…

Q: Discuss the Pharmacokinetics of morphine sulfate using the correct sequence you  have chosen in…

A: Morphine is a drug that targets a specific type of receptor that affects multiple processes. It does…

Q: What is a peptidyl transferase,?

A: Ribosomes are the macromolecular machines, found floating within the cytoplasm or attached to the…

Q: What class does your HindIII enzyme belong?

A: HindIII is a restriction endonuclease (RE).

Q: What could be the effects of changing the sequence of DNA in the nucleus in the function and…

A: The enzymes are nothing but proteins. They are made up of amino acids. The activity of the enzyme…

Q: Write the following oligopeptide using the one letter code for the amino acids: Cys-His-lle-Leu-Glu…

A: One letter code has been assigned to each and every amino acids and is often used to represent the…

Q: For the following sequence, what is the approximate annealing temperature? 5'-AGCTACGATCAGGTCA-3'

A: PCR (Polymerase Chain Reaction) is divided into three main steps : Denaturation of DNA, Annealing of…

Q: What is the effect of denaturing an enzyme?

A: Enzymes are the proteins which act as a catalyst in chemical reactions. Enzymes never take part in…

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids…

A: Lactose permease Its belong to transmembrane protein family. The transport mechanism of lactose…

Q: Which disease occurs when homogentisic acid oxidase is defective?

A: Genes contain all information of proteins forms inside the body. It contains genetic information…

Q: Idris has successfully extracted enzymatic proteins from the fish viscera (intestines and stomach).…

A: The first step after crude protein isolation from any sample is the quantification of the total…

Q: Idris has successfully extracted enzymatic proteins from the fish viscera (intestines and stomach).…

A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation energy…

Q: What is the mechanism of an enzyme reaction involving a coenzyme for Redox Rxns?

A: Enzymes are a class of proteins that performs various activities in the living body. They are also…

Q: Name the enzyme responsible for removal of 5 – phosphate group from nucleic acid?

A: Nucleic acids are long chain compounds made of a series of identical building blocks called…

Q: What exactly is a ribozyme? Can you please give me some real-world examples and explain what makes…

A: A ribozyme is an RNA enzyme that catalyzes biochemical reactions and is capable of specific…

Q: As we focused on the translation of mRNA into proteins as well as on protein structure and function.…

A: One gene one enzyme hypothesis, proposed by Beadle and Tatum, says that each enzyme produces a…

Q: Why is trypsin an unusual name for an enzyme? (What is the convention for enzyme names?)  .

A: The enzymes are the biocatalyst that perform specific biochemical reaction within the body and after…

Q: What is Shine-Dalgarno sequence? In which groups of microorganisms it is found?

A: Translation is the process of synthesis of protein using mRNA ASA template strand .  Process of…

Q: Why is a strong reducing agent, such as NaBH4, not suitable for use in the conjugation of an…

A: Oligosaccharides are molecules that consist of many smaller monosaccharide units. Oligosaccharides…

Q: Five amino acids were subjected to reverse phase chromatography, and the following Rf values were…

A: The normal phase chromatography has a polar stationary phase and a non-polar mobile phase. The…

Q: Five amino acids were subjected to normal phase chromatography, and the following Rf values were…

A: Retention factors are useful for the comparison of the results of chromatographic separation of one…

Q: Is it possible to envision models for the behavior of allosteric enzymes other than the ones that we…

A: Yes, it is possible to envision models for the behaviour of allosteric enzymes other than the ones…

Q: How is ubiquitination attached to the protein of interest? At which amino acid residue(s)? What…

A: Hello! Since you have posted multiple questions, we are answering only first question. If you need…

Q: Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide…

A: The amino acids that form peptide chains can be either polar/non-polar, charged/uncharged,…

Q: What is a lactose analog?

A: Carbohydrates are referred to bio-molecules that consist of polyhydroxy aldehydes or polyhydroxy…

Q: The prepared dish called squash soup, what is the enzymes that may potentially occuring in it?

A: Butternut squash soup has many health benefits. It is packed with nutrients. It is low on fats. It…

Q: In two to three sentences, what are the biochemical features and properties of enzymes?

A: Almost all enzymes are the proteins. Enzymes like any proteins have a primary structure ie the…

Q: Can you please identify what type of protein this is?

A: The correct answer is "Antiparallel beta confirmation"

Q: What are the two major molecular types of enzymes found in living cells.

A: The enzymes are the chemical compounds, which enhance the rate of reaction by assisting the…

Q: What is aminoacyl (A) site ?

A: The A-site (A for aminoacyl) of a ribosome is a binding site for charged t-RNA molecules during…

Q: what are the necessary conditions for the okazaki fragments

A: Nucleic acid synthesis occurs solely within the 5'->3' direction as a result of the…

Q: Given the following biosynthesis scheme, answer the questions (a)-(c) below. OH Me Li C E Me Me SACP…

A: For the synthesis of unbranched fatty acids, living beings carboxylate Acetyl CoA  to yield malonyl…

Q: What type of protein structure does the active form of Catechol-oxidase most likely possess?

A: Catechol oxidase is a copper oxidase and contains a type 3 di-copper cofactor. It catalyzes the…

Q: After gel electrophoresis, it is common to extract a protein (or proteins) from a band in the gel,…

A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first…

Q: Which of the following is FALSE with regard to lysozyme?

A: This function is carried out by the immune system. Immunity is divided into innate and adaptive.…