Illustrate the biosynthetic pathway of resin 2. Give 5 industrial uses of resins
Q: . Using electron flow arrows, show electron transfer from nadh to fmn in complex 1 of the electron…
A: The electron transport (ETC) chain is coupled with ATP synthesis. ETC occurs in Cristea…
Q: If a person has a medical condition in which their mitochondria do not function properly, what…
A: Mitochondria are popular as the powerhouses of the cell. It is the organelle which specifically act…
Q: (continued) B. From a metabolic engineering perspective, why did the researchers heterologously…
A: Zymomonas mobilis is a gram negative facultative anaerobic bacteria. It ferments the pyruvate into…
Q: 1-How is a total cholesterol test different from a lipid panel?
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Beginning an endurance training programme can increase body weight because in the first few days of…
A: As of now days we can see the obesity is major concern infornt of people , increase weight of people…
Q: List down the specific functions of the component structures of mitochondrion relative to cellular…
A: The mitochondrion is a membrane-bound organelle. It is called as powerhouse of the cell, it plays a…
Q: Which among the following The colored solution formed as a positive result for the Biuret test is…
A: A polypeptide chain has amino acids linked together by a peptide backbone.
Q: Why is it difficult to accurately estimate Km and Vmax values from a Michaelis-Menten plot?…
A: Introduction: The study of reaction rates and how they change in response to changes in the…
Q: How does NH4SO4 affect water structure? What does this have to do with protein solubility? I thought…
A: The solubility of a protein in solution depends on nature of the protein and the concentration of…
Q: Phospholipids have ____ fatty acids while triglycerides _____ fatty acids.
A: Lipids are defined as organic substances insoluble in water but soluble in organic solvents like…
Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: find stereochemistry, (from the structure) , rotational bond and geometrical / optical isomer for…
A: Phenyotin is a synthetic compound and also called Diphenylhydantoin and it is a potent…
Q: If 100% of the free energy from the metabolism of glucose is used for the conversion of ADP to ATP,…
A: The equation for the oxidation of glucose is:
Q: What is the approximate temperature (in both F° and C°) for enzyme activity in the human body?
A: Enzymes are highly efficient biological catalysts that speed up metabolism or the chemical reactions…
Q: How does compromised pyruvate kinase activity lead to anemia?
A: Pyruvate kinase is a catalytic enzyme that catalyzes the final step of glycolysis, which is crucial…
Q: D. Lactate
A: Glycolysis is the phenomenon in which sequence of reactions converted glucose to pyruvate and…
Q: A buffer can protect against changes in pH when hydrogen ion or hydroxide ion is added to a reaction…
A: Buffer solution is two types, Acidic buffer - this is composed of a weak acid and it's conjugate…
Q: (a) Lock and key model versus induced fit model of enzyme activity.
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: Translation is a process of Synthesis of polypeptide chain from mRNA template by using Ribosomes. It…
Q: 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…
A: Pyruvate kinase is an glycolytic enzyme, which catalyzes the conversion of phosphoenolpyruvate (PEP)…
Q: How many chromosomes are there in a body cell of a person with trisomy 21 condition? Select one: О…
A: Trisomy 21 is a genetic chromosomal disorder . Genetic chromosomal disorders are the diesese occurs…
Q: Direct methanol fuel cells (DMFCS) have shown some promise as a viable option for providing "green"…
A: The value of Delta G indicates whether a reaction has a tendency to go forward. From this value, we…
Q: 1.A:Identify the three major chemical buffers of the body B : Choose one and describe the operation…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: Write the metabolism (phase 1 & phase 2) of Phenoxybenzamin
A: Phenoxybenzamine is an alpha-adrenergic antagonist with long duration of action because of longer…
Q: Table of BSA solution absorbance of concentration at 595nm. BSA Concentration (µg/ml) OD595nm Mean +…
A: Protein concentration is measured or determined using the reference standard curve. Proteins are…
Q: CH,0--o CH;0-P-O ČH-OH C=O Ó. 10-C-H H-C-OH H-C-OH O C-H ČH;O-P-0 H-C-OH O CH-O
A: Glycolysis is the metabolic pathway that converts glucose into pyruvic acid.
Q: How many more acetyl CoA are generated from stearic acid than from linoleic acid during beta…
A: The process of beta oxidation of stearic acid yields two distinct products and these are acetyl-CoA…
Q: Consider the Michaelis-Menten equation, below: Vmar S V. k + [S] %3D What is the relationship…
A: [S] : Substrate concentration V= Vmax[S]/(Km+[S]) Vmax: Maximum velocity Km: [S] at which V is…
Q: 4. Enzymes in an enzymatic reaction do not interfere with: a. free energy of reaction b. rate of…
A: Enzymes are the biological catalysts that speed up the rate of reaction by lowering the activation…
Q: 5. Use this figure to summarize how the ATP is used as energy "currency", harnessing some of the…
A: ATP is used as a energy currency due to the presence of two high energy phosphoanhydride bonds…
Q: Give a brief note on Alcohols? Answer should include all pharmacological studies, everything which…
A: The term "mechanism of action" in pharmacology refers to the unique biochemical interaction by which…
Q: Phosphorylation of elf-2 regulates eukaryotic protein synthesis initiation by inhibiting formation…
A: eIF2 in question stand for Eukaryotic Initiaon Factor 2 is a heterotrimeric protein consist of…
Q: The vast majority of structures deposited in the Protein Databank (>95%) have been determined using…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: Thiophene ring contains ------- as heteroatom.
A: Thiophene is a compound with ring structure, in which there will be atoms of two or more different…
Q: Renata enzymatically conjugates a "C-labeled cysteine to a transfer RNA (IRNA), with a UGU…
A: The genetic codon is the three letter codon that specifies the twenty naturally occurring amino…
Q: CH,0-P-O C=0 0. CH;0-P-O CH,OH HO-C-H H-C-OH C-H Ö HO--H ČH,O-P-O- H-C-OH O t. CH;0-P-O
A: Glycolysis is a metabolic pathway of conversion to glucose to pyruvate.
Q: H o-H H Н-С-н `cc- .と、 H toluene phenol エ エ 工王 \\
A: Retention factor The amount which each component of a mixture travels can be easily quantified using…
Q: Calculate the number of phosphates, deoxyribose and ribose, and nitrogenous bases needed for a:…
A: Nucleic acid can be of 2 types: DNA (deoxyribonucleic acid) RNA (ribonucleic acid) DNA carries…
Q: Can you please briefly describe the reaction mechanism that permits the detection of reducing sugars…
A: Fehling's reagent is a reagent commonly employed in differentiation of water soluble carbohydrates…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: 4. Why is the type of cell (aerobic/ anaerobic) important to the purpose of this enzyme?
A: Enzymes are highly efficient biological catalysts that speed up metabolism or the chemical reactions…
Q: do aklaloids minic neutrotransmitters in our bidy? amines contain: a) nitrogen atom b) an acid c)…
A: 1) Ans- a)Nitrogen group. Explanation- Amine is Nitrogen containing compound. There are primary…
Q: Amino acids with non-polar side chains are zwitterions at a. middle pH levels, between the pKa’s of…
A: Amino acids are compounds with an amino group, a carboxyl group, a hydrogen atom, and a variable…
Q: What is the RBC metabolism? How it is connected with the Embden-Meyerhof Pathway?
A: Erythrocytes, often known as RBCs, are a kind of blood cell that is produced in the bone marrow and…
Q: Why is understanding reaction rates significant? Indicate at least 3 key importance of understanding…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: A person with Down syndrome has one less chromosome than normal. Select one: a. False O b. True
A: Down syndrome: This is a genetic disorder associated with abnormal or delayed physical growth,…
Q: Indicate what step each of the events in the glycolysis pathway the following takes place: a. First…
A: Glycolysis is a metabolic pathway which converts glucose into pyruvate.
Q: You are using nitrosoguanidine to “revert” mutant nic-2(nicotinamide-requiring) alleles in…
A: Neurospora can be defined as a genus of ascomycetes fungi. The genus name, which means "nerve…
Q: 1. How is PKD inherited? What gene is responsible for the expression of PK enzyme ?
A: Pyruvate kinase deficiency is an inherited lack of the pyruvate kinase, that gets used by red blood…
1. Illustrate the biosynthetic pathway of resin
2. Give 5 industrial uses of resins
Step by step
Solved in 2 steps
- 1. Give the active substance and activity/indications of the following plant ingredients.4. The primary sweetener in Choc Zero Keto bark is__________?A substance obtained from Willow bark in 1973 was found to reduce fever resulting from malaria, and about a century later to relieve the pain of rheunmatism. What is the ingredient in Willow bark extract? Discuss the proposed mechanism of its action.
- 1. What is Echinolone and where it is found and explain the way of collecting the compound. 2. Explain the procedure for collection of Echinolone from it plant source.2. Name a. at least 5 herbal extracts that are often the main ingredients in astringents and toners b. the benefits or functions of each extract c. the commercial astringent or toner that uses the extractThe shelf life and keeping qualities of fruit and other perishable foods are greatly enhanced through irradiation, saving industry and consumers billions of dollars. How would you personally feel about eating irradiated fruit? How about spices that had been sterilized with ETO?
- A secondary plant compound might be used for which of the following? a new crop variety a new drug a soil nutrient a pest of a crop pest5c)Many important bioactive compounds of plants are found in leaves and roots of a plant. Discuss the advantages and limitations of using callus cultures to produce these metabolites.1. a) Glyphosate (Roundup) is toxic to almost all types of plants. Why is it generally considered to be animal-safe? b) Why does it take at least 7 days for the herbicidal effect to be observed?
- Name five (5) Philippine Plant Extracts that are used or are being studied as alternatives for drug or cosmetic preparations. Under each plant indicate: a. Scientific name (e.g. cocos nucifera) b. Parts used (e.g. bark, roots, etc.) c. Active ingredients (e.g. saponins, tannins, etc.) d. Mode of action of the extract (e.g. antimicrobial, antioxidant, etc.)9. What chemical reaction is undergone by acacia when borax is present? A. Hydrolysis B. Complexation C. Partial decomposition D. Precipitation 10. Which agent/s is unsuitable for Tragacanth mucilage? A. H2SO4 B. NaOH C. NaCl D. All of the above 11. What pressurized dosage forms containing one or more active ingredient? A. Inhalants B. Nebulizers C. Metered dose inhalers D. Aerosols 12. Which substances are prone to creaming? a. Inhalants b. Nebulizers c. Metered dose inhalers d. Aerosols 13. These are the reasons of formulating a topical emulsion, EXCEPT: a. Condition of the skin b. Emollient properties c. Tissue softening d. Anhydrous nature of agentsCreate a synthesis to "The effect of lemongrass (Cymbopogon nardus) extract as insecticide against Aedes aegypti Zulfikar, Wiwit Aditama and Frans Yosep Sitepu"
