In 1973, Stanley Cohen and Herbert Boyer inserted a gene from an African clawed frog into a bacterium. The bacterium then began producing a protein directed by the code found on the inserted frog genė. 1. The newly synthesized material in the bacterium is the direct result of (1) DNA replication (2) rapid DNA synthesis (3) the use of frog DNA (4) the use of bacterial DNA

In 1973, Stanley Cohen and Herbert Boyer inserted a gene from an African clawed frog into a bacterium. The bacterium then began producing a protein directed by the code found on the inserted frog genė. 1. The newly synthesized material in the bacterium is the direct result of (1) DNA replication (2) rapid DNA synthesis (3) the use of frog DNA (4) the use of bacterial DNA

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 1TYU: When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain...

See similar textbooks

Similar questions

Find the complement DNA sequences to the following DNA sequences:Sequence # 1: GATATAGTSequence # 2: GAGGTTCSequence # 3: AACTAGATSequence # 4: CCTATAAGSequence # 5: AACGTGAT
10 samples of genetically modified organisms ( Animals ) With brief descriptions of each
What was the first, DNA or RNA? Justify your answer with solid reason
If Avery, MacLeod, and McCarty had found that samples of heat-killed bacteria treated with RNase and DNase transformed bacteria, but that samples treated with protease did not, what conclusion would they have drawn? a. Protease carries out transformation. b. RNA and DNA are the genetic materials. c. Protein is the genetic material. d. RNase and DNAse are necessary for transformation
A segment of DNA has the following sequence:TTGGATGCTGAACCTACGACA. What would the sequence be immediately after reaction withnitrous acid? Let the letters H represent hypoxanthine and Urepresent uracil.B. Let’s suppose this DNA was reacted with nitrous acid. Thenitrous acid was then removed, and the DNA was replicated fortwo generations. What would be the sequences of the DNAproducts after the DNA had replicated two times? (Note:Hypoxanthinepairs with cytosine.) Your answer should containthe sequences of four double helices.
Antibiotic-resistant bacteria have become a stubborn challenge for scientists. Should bacteriophages be used to save the lives of patients in which other treatments have failed?
If Avery, Macleod, and McCarty had observed transformation after removing DNA and RNA, but NOT after removing proteins, they would have concluded that _______. Group of answer choices A polysaccharide is the genetic material in Streptococcus pneumoniae RNA is the genetic material in Streptococcus pneumoniae The genetic material in Streptococcus pneumoniae is a protein Mice with diets rich in proteins are resistant to Streptococcus pneumoniae infection The preparations were contaminated
Organisms require ______ and ______ to maintain themselves, grow, and reproduce. a. DNA; energy b. food; sunlight c. nutrients; energy d. DNA; cells
DNA is often referred to as the “blueprint for life.” Why?
When a bacterium takes up naked DNA from the external environment and incorporates it into its genome , thereby gaining new characteristics this is called______? maybe transformation??
Write out the resulting DNA molecules after the following double stranded DNA molecule is digested with EcoRI: 5’-ATGTTAGAATTCTACGTCGAATTCAAATTT-3’ 3’-TACAATCTTAAGATGCAGCTTAAGTTTAAA-5’
Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a) HpaI, recognizes 5’ GTT – AAC 3’ 5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’ Number of fragments of DNA:…