Q: What result in adaptation comes from natural selection?
A: Evolution is a naturally occurring continuous process in nature that involves changing species…
Q: It has been a really bad day at the hospital. The maternity ward staff has mixed up four female…
A: There are mainly four types of blood groups which A,B,AB and O based on the presence of antigens and…
Q: Imagine that an mRNA molecule, with the following sequence of bases was translated by a ribosome: 5'…
A: Translation is the process of decoding genetic information encoded in messenger RNA (mRNA) to create…
Q: Can the mosquito speak? What about the earthworm and malaria plasmodium
A: Speaking is an art and it is a cognitive ability that is controlled by the broca's area present in…
Q: Explain 1 way each of the following can occur. In your answer, say whether non- disjunction occurs…
A: Introduction : When sister chromatids or homologous chromosomes fail to correctly separate during…
Q: List and explain four ways in which Environmental DNA has changed the field of conservation biology.…
A: Introduction : Environmental DNA is DNA that has been extracted from environmental materials and…
Q: Ovulated oocyte Oocyte Ovarian ligament Ruptured follicle Primary follicles Primordial follicles…
A: The ovary is a female reproductive system primary gonad. It generates female reproductive cells…
Q: Which of the following is an example of canalization? O A child walks early due to practice and…
A: Canalization is the tendency for development of a perticular genotype to follow the same trajectory…
Q: The Siamese cat breed has a light‑colored body and dark‑colored head, tail, and feet, all of which…
A: Cross breeding, also known as hybridization, is the process of breeding two different species or…
Q: Phenotypic Variation 1. What was the effect of medium type on pigmentation in strain 30-84 and…
A: Note:- Sorry, there seems to be some missing information (type of media) for the subquestion of part…
Q: 9. Match the letter of the functional groups to the correct name.
A: Amino group ---- D. ----NH2 An amino group is a component of an amino acid. The amino group's…
Q: . Three autosoma etween gene Aa istance between dividual who is
A: Recombination frequency is taken into account in genetic mapping as a measure of distance between…
Q: Which type of selection (directional, disruptive, stabilizing) changes the overall average phenotype…
A: Introduction : A crucial phase in the evolution process is natural selection. According to this…
Q: 5) Humans who have an abnormally high level of cholesterol are said to suffer from familial…
A: Introduction :- Familial hypercholesterolemia is an inherited disorder characterized by elevated…
Q: Nonalcoholic fatty liver disease is thought to be exacerbated by a diet heavy in sugar. Explain?
A: Introduction :- Nonalcoholic fatty liver disease (NAFLD) is a condition in which excess fat…
Q: draw a punnett square, both parents are mixed hybrids, name the 4 possible offspring and the…
A: The above question asks for the construction of a Punnett square, which is a graphical…
Q: ment 1 (Chapter 1-3) i Click and drag each label to identify which phase of meiosis it describes. A…
A: Meiosis is a type of cell division that occurs in sexually reproducing organisms and results in a…
Q: Somatostatin
A: Introduction A hormone is a chemical messenger produced by glands in the endocrine system that…
Q: Explain a way that sensory nervous system transduce stimuli with different strengths using concept…
A: The nervous system is a complex network of nerves and cells that send signals throughout the body.…
Q: Dr. Joyce Poole and her research team also conduct studies in Gorongosa National Park in Mozambique…
A: Phenotype refers to the physical expression or traits of an organism. The phenotypic frequency is…
Q: In the United States, approximately one in three babies is delivered via cesarean (c-section).…
A: A caesarean delivery is characterized as the delivery of a foetus through incisions made in the…
Q: Chi-square is a statistical test comparing a set of observed data against expected data to check for…
A: Introduction A hypothesis is a tentative explanation or prediction about a phenomenon that can be…
Q: What happens to the range of values you obtain as the number of beans in the sample increases? If…
A: As the number of the beans in a bag increases the standard deviation decreases. So if 15 bean…
Q: Speculate about the following details of mitosis. 1. Why do chromosomes need to condense during…
A: MITOSIS The cell duplication is known as mitosis, one cell divides into two genetically identical…
Q: Mapping high-throughput sequencing reads (choose all that apply) O requires a special device called…
A: Mapping high throughput sequencing refers to the amount of DNA molecules that read at the same time.…
Q: Problem. A 1-year-old child was admitted to the clinic with signs of damage to the muscles of the…
A: Introduction :- Carnitine is an important molecule in muscle metabolism, as it plays a crucial role…
Q: There may be more than one answer for each Expression of mRNA can be regulated by which of the…
A: There are a few important points : RNA polymerase is responsible for the transcription of all…
Q: draw a punnett square for ggBB and GGBb.
A: The genotypes of an individual refer to the arrangement or the type of gene combination that an…
Q: Briefly explain WHY a 5 7-methylguanosine cap is only added to mRNA, not to tRNA or rRNA. (Please…
A: Introduction DNA is a self replicating molecule. Transcription is a process by which mRNA is…
Q: Calculate the CFU per mi SAMPLE 1.0.0.0.0.0. 1000 1000 1000 허허허 Conf. >500 TNTC 400 inete meds mees…
A: Given is the dilution and number of colony forming units (CFU) in different plates. We have to…
Q: What is the size range for most typical bacteria? Both of these are correct 200-2000 nanometers x…
A: Introduction : Bacteria belong to a large group of microscopic, unicellular living organisms.…
Q: Table 2 below contains a set of data on batch fermentation of Saccharomyces cerevisiae (wild-strain)…
A: To calculate the specific growth rate, we use monod equation. U(s) = (Um × S) / (Ks + S).
Q: Explain how oxidation of a substrate proceeds without oxygen.
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: This diagram shows two homologous chromosome pairs from a mouse after DNA replication. Chromosomes…
A: Cell cycle is series of events. It is responsible for dividing the parents and into daughter cells.…
Q: The relationship between SES and health can be described as: Biological difference Measure of…
A: People with lower socioeconomic status (SES) have higher morbidity and mortality rates than those…
Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…
A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…
Q: Which structure with a diameter of 20 nm is found attached to membranes in a cell? a) Golgi body b)…
A: The plasma membrane, also known as the cell membrane, is the membrane found in all cells that…
Q: . What are differences between prokaryotes and eukaryotes?
A: Prokaryotes consists of nucleoid and it is not membrane bounded. Nucleus present in prokaryotes is…
Q: Consider an animal. During DNA replication, all base pairs of DNA are copied. But, during…
A: Introduction: DNA (Deoxyribonucleic acid) is a long, double-stranded molecule that carries the…
Q: What are advantages and disadvantages of each type of animal body plan?
A: Introduction A body plan, in the context of biology, refers to the overall shape and organization…
Q: Fill in the blanks The discovery that genes can move from one chromosome location to another was…
A: Introduction: A DNA sequence known as a transposable element (TE) is able to migrate, or…
Q: answer the 3 parts
A: A phylogenetic tree represents the evolutionary relationship between organisms and their ancestors…
Q: eologists find a new pyramid containing a mummy's sarcophagus. Many people from different fields of…
A: INTRODUCTION A pyramid is a structure consisting of a base, usually a square or rectangular shape,…
Q: H 1-2 11-1 11-8 III-1 IV-1 IV-7
A: The individuals that could be only heterogenous are as follows- A. I-1 C. I-4 E. II-4 I. IV-1 J.…
Q: Q.A protein has two domains, which are labeled with two probes for energy transfer. Calculate the…
A: Introduction Energy transfer is a process by which energy is transferred from one molecule to…
Q: 5. Deficiency of gene 5 expression leads to duplex kidney phenotype. Determine genotype(s) of mice…
A: Gene expression means to form a protein by a particular DNA sequence. It is a lengthy process which…
Q: Explain possible explanations for the differences noted among the diffusion rates of the three…
A: Among the few factors that affect the diffusion rate, molecular weight is the major one. As is…
Q: Question: What are pharyngeal pouches? a) Is a grandulan groove in the floor of the pharynx and is…
A: Introduction Pharyngeal pouches are folds in the embryonic stage of chordates that give rise to…
Q: Task 1 A. Give one example of genetic variation and one other example of environmental caused…
A: Genetic variation refers to differences in an individual's DNA sequence, which can result in…
Q: 6. In RNA, why can uracil be used in place of thymine? * O The structural difference between thymine…
A: Nucleic acid is a macromolecule which is involved in storage pf genetic material . It is involved in…
in great detail explain what a Nucleus is, the function, location and why it is so important.
Step by step
Solved in 2 steps
