In the genome of Zea mays, in the segment 120M to 120,030k of Chromosome 5, what repeatelements do you find using Repeat Masker?O 18 simple repeats, 5 LTR elements21 simple repeats24 LTR elementsO 19 LTR elements, 3 simple repeats

A monoecious plant has male and female flowers on the same plant, or flowers that have both male and…

In the genome of Zea mays, in the segment 120M to 120,030k of Chromosome 5, what repeat elements do you find using Repeat Masker? 18 simple repeats, 5 LTR elements O 21 simple repeats O 24 LTR elements 19 LTR elements, 3 simple repeats

In the genome of Zea mays, in the segment 120M to 120,030k of Chromosome 5, what repeat elements do you find using Repeat Masker? 18 simple repeats, 5 LTR elements O 21 simple repeats O 24 LTR elements 19 LTR elements, 3 simple repeats

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter15: Biotechnology

Section: Chapter Questions

Problem 2CT: The results of a paternity test are shown in the table below. Numbers indicate the number of short...

See similar textbooks

Related questions

Q: What is the specific molecule recognized in our ELISA to measure phospholipase C activity? How is it…

A: Snadwisch ELISA method can be to measure phospholipase c activity can detect the level of PLCG2…

Q: what part is pointed in letter D?

A: Introduction A cell is a cytoplasmic mass that is outwardly bound by a cell membrane. Cells are the…

Q: 6. Which of the following statements best explains why cancer is so difficult to cure? O A. Each…

A: Cancer is a condition in which some cells in the body grow out of control and spread to other parts…

Q: To determine: The trophic levels and the way in which they are related to ecological pyramids.

A: The Sun provides energy to the Earth in the form of light. The organisms efficiently exploit the…

Q: how should we prepare for the next pandemic? What project that can be implemented to avoid future…

A: Introduction Pandemic:- A pandemic is the worldwide spread of a new disease, It is a disease…

Q: 7. The average length of the double helix in human chromosome is 3.8cm. i. Approximately how many…

A: Dna is the polymers of nucleotides . Two consecutive nucleotides in the dna are separated by the…

Q: Which of the following objects would you use microinjection in order to transfer DNA into? a. Egg…

A: Microinjection is the process of transferring DNA materials into a living cell. It can be done by…

Q: The development of DNA technology is bringing profound changes to science, agriculture and…

A: Introduction DNA technology is an extremely important research tool in biology as it allows the…

Q: C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' i. What would be the first 5 bases at the 3' end of the…

A: 3' C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' Complementary strand- 5'- CTCAATTCCGAGGATCCAAT-3' i)…

Q: bacteria

A: Auxotrophic strains lack the ability to synthesize one essential compound for example amino acid.…

Q: To explain: The way in which predator-prey relationship is affected by natural selection.

A: Charles Darwin was an English naturalist who was interested in outdoor activities from a young age.…

Q: Question How does the female reproductive system protect itself from pathogens?

A: Pathogen It is defined as the organism that have the ability to cause a disease. The microbes cause…

Q: Briefly describe another technique you can use to study the interaction of Vitamin D3 with lipid…

A: Vitamin D3 with lipid membrane interaction.. Vitamin d3 is very important for our body as it…

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A: DNA contains the genetic information about the characteristics features of te organism present in…

Q: What about Phloem?

A: Plants, of course, do not absorb food in the same manner that humans do. Rather, while…

Q: Is an increase in albumin excretion observed only in pathological urine? Why or why not?

Q: from stimulus to effector muscle

A: We know that nervous system will coordinate and control the activities of animals and humans .…

Q: One objection many people have about vaccinations is the amount and variety of chemicals in them.…

A: Vaccination is a simple, safe and effective way of protecting you against harmful diseases. It uses…

Q: . How does temperature affects the BFC and WFC? And how can it be a potential cure for obesity? 2.…

A: Brown fat increases metabolism upon body exposed to cold temperatures.Brown fat breaks down to…

Q: escribe the behavior and neural mechanisms involved luring cricket communication used for…

A: Crickets are nocturnal, so they chirp at night. Male chirp to attract the female for mating. “…

Q: How many amino acids would there be in the protein produced from the following mRNA molecule ?…

A: 1. Stop codons- UAA, UAG and UGA. Codon consists of 3 nucleotides. There are 11 codons, but 10…

Q: While you were driving to San Francisco, you saw many billboards on the highway but you could not…

A: The smallest level of stimulation that may be recognised is known as an absolute threshold, which is…

Q: Define the term “carbon neutral,” and describe how biomass-based sources have the potential to be…

A: The earth is inhabitable because of the presence of water bodies and oxygen. The atmosphere of earth…

Q: Petunias normally have purple flowers. Suppose you identify a recessive mutant that has white…

A: Petunia have purple flower in wild type phenotype. Whereas the white flower are present due to…

Q: The epidemic that infected Europe, North Africa, and theMiddle East and killed tens of millions of…

A: Introduction An epidemic is a sudden increase in the number of instances of a disease beyond what…

Q: The elderly tend to have difficultly absorbing vitamin A with age. O a) True b) False

A: Vitamins are the organic compounds which are required by our body in small amounts for maintaining…

Q: Question - Summarize the goals of conservation biology .

A: In Conservation biology the bio-diversity of earth and nature is conserved. It is a…

Q: Explain auxin’s effect on growth and how it causes plant cellsto enlarge.

A: Plants naturally produce auxins, a potent growth hormone. They promote cell division, stem and root…

Q: DNA DNA Leading strand mRNA tRNA Amino Acid A T G A A A G T C A T…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: Which of the following does NOT play a role in DNA replication? O helicase promoter O ligase…

A: ANSWER;- None of the above Explain;- Does not play a role in DNA replication is a stop codon. -Stop…

Q: Male spotted bugs often allow the female to eat them during mating. You are a scientist studying…

A: From the graph it can be concluded that the average number of eggs are much more when males are…

Q: Consider the similarities and differences in the cell cycles (mitosis and meiosis) of plants and…

A: Mitosis and Meiosis similarity 1. Both occur during cell reproduction. 2. Both occur in stages.…

Q: Question - Summarize the goals of conservation biology .

A: Conservation biology- It is an applied science based on ecological principles. it focuses on…

Q: To explain: The typical pyramids of numbers, biomass, and energy.

A: The sun provides energy to the Earth and actually defines that they're supposed to form through and…

Q: All of the following have contributed to the obesity epidemic in young teens EXCEPT: a) increased…

A: Obesity is a national problem that contributes to some of the country's leading causes of mortality,…

Q: A population has 700 individuals, 85 of genotype AA, 320 of genotype Aa and 295 of genotype aa. What…

A: The Hardy-Weinberg equation is expressed as: p2 + 2pq + q2 = 1 p is the frequency of the "A" allele…

Q: How could you distinguish among carbohydrates,lipids, proteins, and nucleic acids?

A: A macromolecule, including a protein or nucleic acid, is indeed a very big molecule crucial to…

Q: 10. Phagocytosis by a phagocyte is required for: B cell action b. helper T (T4) cell action c.…

A: Answer

Q: Supported lipid bilayers (SLBs) are widely used in biophysical research to investigate the effect of…

A: Supported lipid bilayer or SLB is the artificial platform based on solid surface, that can mimic the…

Q: Is this type of ETi sweets harmful? Wale "up wafer with COCoa cream

A: Is the sweets like water with cocoa cream harmful?

Q: (Y=black/y-yellow). The heterozygotes are the color mixture called calico or tortoise-shell. What…

A: The coat color is encoded by the genes present on the X chromosomes. The black color is present in…

Q: All of the following are benefits of breast feeding EX a) The baby will receive complex…

A: In infants below 6 months of age, it's advised that breastfeeding is to be followed. Breastfeeding…

Q: a catabolic process.

Q: Can you pls go into more detail regarding the growth regulators and how it works.

A: Plant Growth regulator(also known as plant hormones) are a group of chemical compounds that have a…

Q: chromosomes will there be in the cells at the When, during the life of an organism, would you expect…

Q: Match the following scientists who emerged in specializedfields of microbiology to their famous…

A: Introduction :- Virology is the study of viruses and virus-like entities, which are submicroscopic…

Q: Hello, Please answer the following attached Microbiology question AND ANSWER ALL 3 PARTS COMPLETELY.…

A: There are several staining methods are already discovered and continuously used in microbiology one…

Q: Why does a red blood cell plasma membrane need transmembrane proteins?

A: Introduction:- RBCs require transmembrane protein to connect the cell's outside with its interior.

Q: You are a scientist studying the relationships between lizards, penguins, and parrots. You examine…

A: The trait no body temperature regulation is found in al common ancestors and hence will be a…

Q: 9. Coronary arteries route oxygen leH of the: d. descending aorta halpern round-a-bout a.…

A: Coronary artery supplies the fresh blood to the heart wall. It is of following types-Left anterior…

Concept explainers

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.

Question

In the genome of Zea mays, in the segment 120M to 120,030k of Chromosome 5, what repeat
elements do you find using Repeat Masker?
O 18 simple repeats, 5 LTR elements
21 simple repeats
24 LTR elements
O 19 LTR elements, 3 simple repeats

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A method for detecting methylated CpGs involvesthe use of a chemical called bisulfite, which convertscytosine to uracil but leaves methylated cytosine untouched. You want to know whether a particularCpG dinucleotide at one location in the genome ismethylated on one or both strands in a tissue sample.The genomic sequence containing this CpG is:5’...TCCATCGCTGCA…3’. You take genomicDNA from the sample tissue, treat it exhaustivelywith bisulfite, and then use flanking primers toPCR-amplify the region including this CpGdinucleotide. You then want to Sanger sequence(see Fig. 9.7) the amplified PCR product. a. After you treat genomic DNA with bisulfite, the twoDNA strands will melt into single strands. Why?b. Your answer to part (a) introduces a potential complication, because if you do not account for this result of bisulfite treatment, the PCR primers willnot amplify the DNA. What special considerationswould be necessary when you design your PCRprimers for this experiment? Could one pair…
If you are comparing the two telomeres in each entryin the following list, in which cases would you expectthe two telomeres always to have exactly the samenumber of TTAGGG repeats?a. One telomere at one end of a chromosome, one telomere at one end of a nonhomologous chromosome.b. One telomere at one end of a chromosome, onetelomere at the corresponding end of the homologous chromosome.
If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?
. Use the following sequence data to assign haplotypes and build a haplotype network for a 200 bp variable region that is sequenced from eight individuals. Polymorphic nucleotide positions are shown. Δ is a 1 bp deletion. Explain the logic supporting the network. If there are different nucleotide changes at one position, indicate the different changes on your network. Individual 24 56 92 119 146 172 haplotype 1 A C A T G G A 2 T C Δ C G G 3 A G A T A T 4 A G A T G T 5 A C Δ C G G 6 A G A T G G 7 A G A T A T 8 C C Δ C G G
If you are comparing the two telomeres in each entryin the following list, in which cases would you expectthe two telomeres always to have exactly the samenumber of TTAGGG repeats?a. One telomere at one end of a chromosome, one telomere at one end of a nonhomologous chromosome.b. One telomere at one end of a chromosome, onetelomere at the corresponding end of the homologous chromosome.c. One telomere at one end of a chromosome, theother telomere at the other end of the samechromosome.d. One telomere at one end of a chromatid, the othertelomere at the corresponding position in the sisterchromatid.
The presence (+) or absence (−) of six sequences in each of five bacterial artificial chromosome (BAC) clones (A–E) is indicated in the following table. Using these markers, put the BAC clones in their correct order and indicate the locations of the numbered sequences within them.
The two forms of Non-retroviral mobile DNA elements which are observable in huge numbers in the genomes of mammalian (incl. human) genomes are known as: Question 19 options: LINE & SINE/Alu sequences LINE sequences & IS elements transposons & LINE sequences transposons & retrotransposons SINE & Alu sequences
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
Below is a portion of an exon from a gene that encodes protein Y in the genome of the plant Brassica. Wildtype DNA3’ CTT AAT GCT CCG AAT CCA 5’ template strand5’ GAA TTA CGA GGC TTA GGT 3’ non-template strand A new strain (Strain X) of Brassica is identified with the same region of the gene coding for protein Y:3’ CTT AAT GCT GCG AAT CCA 5’ template strand5’ GAA TTA CGA CGC TTA GGT 3’ non-template strand Compare the sequence of Wildtype with Strain X DNA, and note the following: Whether there is a mutation. If there is a mutation, what is the type of mutation (be as specific as possible) and explain the rationale for your decision. Assuming this is the only difference between the Wildtype and Strain X, describe the potential impact of the mutation on the structure and function of the protein.
Although DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements usually make up the largest fraction of very large genomessuch as those from humans (~2500 Mb), maize (~2500Mb), and barley (~5000 Mb). Given what you knowabout class 1 and class 2 elements, what is it about theirdistinct mechanisms of transposition that would accountfor this consistent difference in abundance?
You learned in Problem 21 in Chapter 7 that theneurodegenerative disease ALS can be caused by expansion of a hexanucleotide repeat region (5′-GGGGCC-3′)outside of the open reading frame (but within the firstintron) of the gene called C9ORF72. While a normalC9ORF72 allele has 2–23 copies of the hexanucleotiderepeat unit, dominant disease-causing alleles have hundreds or even thousands of copies. Researchers observed that the first intron of theC9ORF72 disease allele is transcribed not only fromthe normal template strand of DNA, but also from thenontemplate strand. Even more unusual, both types ofrepeat-region transcripts are translated in all six readingframes in an AUG-independent manner—a processcalled repeat-associated non-ATG translation, or RANtranslation. These discoveries led to the hypothesisthat the proteins made from the repeats mightcontribute to ALS.a. What polypeptides are made from the repeat-regiontranscripts?b. According to the RAN translation hypothesis, whyare…
The two forms of Non-retroviral mobile DNA elements which are observable in huge numbers in the genomes of mammalian (incl. human) genomes are known as: Question 40 options: LINE & SINE/Alu sequences LINE sequences & IS elements SINE & Alu sequences transposons & retrotransposons jumping genes & deletors