Jenny and Joe are heterozygous for green eyes which is recessive. They have 5 children. What is the chance that none of their children have green eyes? a) 0 b) 1/4 d) 3/4 d) 243/1024 Jenny and Joe are heterozygous for green eyes which is recessive. They have 5 children. What is the chance that all their children have green. eyes? O O a) 1/1024 b) 1/64 1/4 d) 0
Q: 36. Which of the following motifs can be found in DNA-binding proteins? a.) helix-loop-helix b.)…
A: Proteins with DNA-binding domains, or DNA-binding enzymes, have a particular or universal attraction…
Q: Ms. Dela Cruz reports to her radiation oncologist that she missed her period for a month and might…
A: Miss Dela Cruz is suffering from cancer and as a part of a treatment plan she is receiving Radiation…
Q: why riboflavin absorbs in the UV-Vis region
A: Riboflavin, also referred to as Vitamin B2, is a water-soluble vitamin that is crucial for the…
Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…
A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…
Q: Would the biologist agree or disagree with the following statements? a) Since there was no…
A: Introduction :- Habitat refers to the place or type of environment where an organism lives and…
Q: Phenotypic ratio when crossing two pure-breeding organisms Tester for a test cross Independent…
A: Phenotypic ratio of a cross between two pure breeding organisms will result in all the progeny…
Q: A man infected with the bacterium, Escherichia coli, was treated with the correct antibiotic. E.coli…
A: Introduction E. coli is a type of bacteria that normally lives in the intestines of humans and…
Q: MUSCLES (a) relaxed sacromere (b) contracted sacromere What is a sarcomere? Maria Wiek: weinely B…
A: INTRODUCTION Muscles are bundles of specialized cells in the body that contract to produce movement.…
Q: Mapping high-throughput sequencing reads (choose all that apply) O requires a special device called…
A: Mapping high throughput sequencing refers to the amount of DNA molecules that read at the same time.…
Q: Choose which one Hypotonic, Hypertonic, Isotonic
A: Introduction: The cell membrane, also known as the plasma membrane, is a thin, semi-permeable…
Q: Draw the three different cell junctions, and explain how the structure of one of these junctions…
A: In tissues, cells are connected to one another via cell-cell junctions, which also control tissue…
Q: Basic body color for horses is influenced by several genes, one of which has several different…
A: It is a question related to the incomplete dominance which are heterozygous conditions are shows.
Q: (A labeled hand drawing is OK). 1. Trace the pathway of water through a Leuconoid sponge. Name all…
A: Leuconoid sponges represent an important stage in the evolution of sponges, as they are the most…
Q: 3. In the space below, draw a mo transport. Include an example of an appr out in Diffusion out in
A: Human body is dynamic as there is continuous exchange and transport of materials from one cell to…
Q: What is the main question they addressed in "MicroRNAs Control De Novo DNA Methylation Through…
A: INTRODUCTION Mouse Embryonic Stem Cells (mESCs) are cells that are derived from the inner cell mass…
Q: Many biochemical reactions are non-spontaneous but are required for living organisms. How can they…
A: Chemical processes known as "biochemical reactions" happen within the cells of living beings. The…
Q: Solve the following Solution X = 1 OsM glucose Solution Y = 2.5 OsM glucose • Solution Z = 1 M NaCl…
A: Given that Solution X = 1 OsM glucose Solution Y = 2.5 OsM glucose And Solution Z = 1 M NaCl
Q: Daughter cells produced at the end of meiosis II have Multiple Choice twice the number of…
A: The process by which the parent cells divide their genetic material into two or more daughter cells…
Q: How is an epidural administered? Oby taking a pill through a breathing mask or tube Oby intravenous…
A: Ans: Epidural is a procedure in which the local anaesthesia is injected into the space around the…
Q: Explain how oxidation of a substrate proceeds without oxygen.
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: More people die from injuries each year than malaria, tuberculous and HIV combined. True False?
A: Injuries are a major cause of death and disability around the world, but many people don’t realize…
Q: draw a punnett square for both parents are dominate tall, name the 4 possible offspring.
A: Punnett square is a square diagram which is used to find the genotypes of a cross. It is used to…
Q: The major bonds in cellulose are α(1→4) bonds. During mRNA splicing, U2 binds to the 3’ splice site.…
A: 1.The major bonds in cellulose are α(1→4) bonds. (False) Cellulose is the most important structural…
Q: Advantages and disadvantages of each type of body plan of animals?
A: Radial, bilateral, and asymmetric body plan symmetry are the three categories by which animals can…
Q: The wild cress Arabidopsis thaliana is a diploid with 5 pairs of homologous chromosomes (i.e. 2n =…
A: Introduction :- Meiosis is a type of cell division that produces haploid cells, which contain half…
Q: racing the evolutionary thought was not easy because of many scientists who were interested in this…
A: Tracing the evolutionary thought was not easy due to the interest of many scientists. However, it is…
Q: You perform a ten-fold serial dilution of a bacterial culture to determine the number of colony…
A: INTRODUCTION Serial dilution is a laboratory technique used to create dilutions with a precise and…
Q: 5) Humans who have an abnormally high level of cholesterol are said to suffer from familial…
A: Introduction :- Familial hypercholesterolemia is an inherited disorder characterized by elevated…
Q: Passive nonvoluntary euthanasia is the one kind of euthanasia that is almost always morally…
A: Euthanasia is the act of intentionally ending the life of a person in order to relieve them of…
Q: A mother wants to find ways to remind her infant of her while she is not there. Which artifact would…
A: A newborn or infants senses are developed but not as precisely as in others.
Q: Craig Venter's group reported sixfold coverage of the H. influenzae Rd genome. Given that the genome…
A: Craig Venter's group was able to sequence the human pathogen Haemophilus influenzae Rd genome with…
Q: Discuss the ways that viruses can be cultivated. Define the terms plaque and necrotic lesion.
A: Introduction A virus is a tiny infectious particle that can cause disease in living organisms. It…
Q: Speculate about the following details of mitosis. 1. Why do chromosomes need to condense during…
A: MITOSIS The cell duplication is known as mitosis, one cell divides into two genetically identical…
Q: How is collenchyma and sclerenchyma tissue similar
A: Collenchyma, parenchyma, and sclerenchyma are permanent tissues forming the ground tissue in the…
Q: Considering that Noor and Hamza do produce a first child and name her Roop, what is the likelihood…
A: PKU (Phenylketonuria) is an inherited disorder caused by a lack of the enzyme phenylalanine…
Q: Explain possible explanations for the differences noted among the diffusion rates of the three…
A: Among the few factors that affect the diffusion rate, molecular weight is the major one. As is…
Q: can you show how do you do the corss to see the result?
A: This is an example of epistasis where the effect of one gene masks the effect of other gene present…
Q: The mode of inheritance of the auricular hypertrichous trait in the Brown family is clearly an…
A: Auricular hypertrichosis is a phenotypic condition in which excessive hair growth takes place in or…
Q: 6. In RNA, why can uracil be used in place of thymine? * O The structural difference between thymine…
A: Nucleic acid is a macromolecule which is involved in storage pf genetic material . It is involved in…
Q: 9. Match the letter of the functional groups to the correct name.
A: Amino group ---- D. ----NH2 An amino group is a component of an amino acid. The amino group's…
Q: CELL MEMBRANE VOCABULARY TERMS LIST Use the terms below to fill in the blanks. Cell membrane Lipid…
A: Cell membrane which is also known as plasma membrane.It forms the external boundary of the cell and…
Q: What is the name on the diagram number 4, 5,6, 9
A: The cross-section of skin has three main layers: the epidermis, dermis, and subcutaneous tissue. The…
Q: List any phenotypes (e.g., physical or behavioral) that might differ between the average person who…
A: Introduction Twins are two offspring produced by the same pregnancy. There are two types of twins:…
Q: Clinical trials can be designed to demonstrate that a new technology offers measurable, relevant…
A: Clinical trial or often termed "medical trials" are research designs aimed to evaluate the…
Q: What came first, the ribosome or the protein? explain in detail why
A: Ribosomes are essential components of cells, responsible for synthesizing proteins from the…
Q: Our phenotypic traits and personalities come from the expression of our genes. When and how do you…
A: Phenotypic traits are the observable physical and behavioral characteristics of an organism, which…
Q: 1. Define the following key terms used in epidemiology: Prevalence Incidence…
A: In epidemiology, the term "Prevalence" refers to the percentage of a certain population that is…
Q: Which of the following cell types is responsible for cavitation-induced spore dispersal in most…
A: INTRODUCTION All living things must have cells since they serve as their fundamental structural and…
Q: d. You have a 10 gram/ml. stock solution of protein. To make 50mL of 25 mg/ml solution, add, of…
A: We are given a 10gm/ml stock solution of protein. We have to makea 50 ml solution with 25mg/ml…
Q: at ed $ 7) a 8) Describe one example of diffusion in the human body. In your description be sure to:…
A: Insulin/Glucagon Diffusion- • We have modeled the rate of insulin and glucagon secretion at the…
Step by step
Solved in 3 steps
- Tay-Sachs disease is a recessive genetic disease. Two individuals, both of whom are heterozygous for a recessive allele that causes the disease have one child who does not have the disease. What is the probability that this child has the potential to pass the disease-causing allele on to the next generation? Tay-Sachs disease is a recessive genetic disease. Two individuals, both of whom are heterozygous for a recessive allele that causes the disease have one child who does not have the disease. What is the probability that this child has the potential to pass the disease-causing allele on to the next generation? 1/4 1/2 3/4 2/3A young couple went to see a genetic counselor because each had a sibling with cystic fibrosis. (Cysticfibrosis is a recessive disease, and neither member ofthe couple nor any of their four parents is affected.)a. What is the probability that the female of thiscouple is a carrier?b. What are the chances that their child will havecystic fibrosis?c. What is the probability that their child will be acarrier of the cystic fibrosis disease allele?Color blindness is typically an inherited genetic condition in which individuals have a decreased ability to see color or differences in color. Color blindness only occurs in individuals who have two recessive alleles for the condition. Normal color vision is due to a dominant allele (C) Color blindness is due to the recessive allele (c) a) If Susan is homozygous for normal vision, and Matt is homozygous for color blindness, what is the likelihood (in percentage) that their son Alex will have color blindness? Perform a Punnett Square (either below or by hand on paper) to find the probability. Provide your answer in a full sentence. If you did the Punnett Square by hand, attach your photo to the next question.
- A is a dominant gene for normal pigment, and a is its recessive allele for albinism (and pink eyes). B is a dominant gene for brown eyes, and b is its recessive allele (blue). What is the mother's genotype if two brown-eyed parents have fraternal twins, one with blue eyes and one with pink eyes (albino)? a. AaBb b. AaBB c. aaBb d. aabb e. AABBA young couple went to see a genetic counselor because each had a sibling with cystic fibrosis. (Cystic fibrosis is a recessive disease, and neither member of the couple nor any of their four parents is affected.) What is the probability that the female of this couple is a carrier? What are the chances that their child will have cystic fibrosis? 3. What is the probability that their child will be a carrier of the cystic fibrosis disease allele?The young woman shown at right has albinismvery pale skin, white hair, and pale blue eyes. This phenotype is due to the absence of melanin, which imparts color to the skin, hair, and eyes. It typically is caused by a recessive allele. In the following situations, what are the probable genotypes of the father, the mother, and their children? a. Both parents have normal phenotypes; some of their children are albino and others are not. b. Both parents and all their children are albino. c. The mother is not albino, the father is albino, and one of their four children is albino.
- A young couple went to see a genetic counselor because each had a sibling affected with cystic fibrosis. (Cystic fibrosis is a recessive disease and neither member of the couple nor any of their four parents is affected). What is the probability that the female of this couple is a carrier and what are the chances that their child will be affected with cystic fibrosis?If a pure breeding(homozygous) black(dominant), longhaired (recessive) cat is made of pure breeding Siamese, shorthaired cat, and one of their male offspring has made it to one of their female offspring, what is the chance of producing a Siamese colored shorthair kitten?Armin and Annie are going to have a baby. Annie has dimples in her cheeks (a dominant trait), while Armin does not. You know that Annie's father has dimples in both cheeks, while her mother does not. Her mother must have the recessive trait. Annie's father has the dominant trait, but you don’t know if he is a homozygote or heterozygote. But you still know what Annie’s genotype must be because Annie must have a recessive allele since that is all she could have inherited from her mother. Since Annie has a dimples you know she inherited a dominant allele from her father. What are the chances Armin and Annie’s baby will have dimples? Determine the Phenotype and Genotype and its probability. Show your solution in a clean sheet of paper.
- The allele for hitchhiker’s thumb (h) is recessive to straight thumb (H). If a man and his wife are both homozygous recessive, will any of their offspring potentially have hitchhikers thumb? What is the man’s genotype and the woman’s genotype? What is the man’s phenotype and the woman’s phenotype? What genotype(s) must the offspring have in order to have the phenotypic trait of hitchhiker’s thumb? Do a cross to determine all potential hitchhiker’s thumb genotypes and phenotypes for the offspring of this man and woman. Is it possible for any offspring of the F1 generation to have hitchhiker’s thumb?Which of the following rows correctly identifies the relationship between the blood type alleles IA, IB, and i? Select one: a. Relationship between IA and IB Relationship between IB and i Incomplete dominance Codominance b. Relationship between IA and IB Relationship between IB and i Multiple alleles Incomplete dominance c. Relationship between IA and IB Relationship between IB and i Dominant and recessive Multiple alleles d. Relationship between IA and IB Relationship between IB and i Codominance Dominant and recessiveWhat is the probability of a child having a recessive disorder if both parents are heterozygous carriers? A. 1/2 B. 1/4 C. 3/4 D. 2/3 E. Zero