Lactic acid fermentation is used to regenerate i. FADH2 ii. ATP iii. NADH iv. NAD'

Q: What does NOT describe a starch?

A: Starch is a polysaccharide that is produced by most of green plants for the purpose of storage of…

Q: Regarding the regulation of the citric acid cycle (TCA), what are the true alternatives: a.the TCA…

A: Allosteric regulation governs the TCA cycle. The metabolites control the cycle through feedback…

Q: С 17 Based on the knowledge you gained from the cloning module, which of the bands in the figure is…

A: Agarose gel electrophoresis is a method used in molecular biology to resolve DNA fragments on the…

Q: What is the purpose of adding the dishwashing liquid to the DNA extraction?

A: DNA extraction is a method of separating DNA from cell membranes, proteins, and other cellular…

Q: A plant isolate was subjected to qualitative tests to determine the presence of macromolecules.…

A: Biological macromolecules are constituted of proteins , nucleic acids (DNA or RNA), carbohydrates…

Q: Which exemplifies substrate level phosphorylation? O Glucose + ATP --> Glucose-6-phosphate…

A: Substrate-level phosphorylation is a metabolism reaction that aids in the transfer of a phosphate…

Q: ACTIVITY 8.1.3 Complete the table Sphingolipid Ceramide Shiphingomyelin Ganglioside Function Name…

A: Introduction: Sphingolipids are complex lipids molecules that contain sphingosine instead of…

Q: Multiple Choice - Explain your answer in 3-5 sentences. - answer properly QUESTION: The allosteric…

A: Proteins that behave as physiological catalysts are known as enzymes. Catalysts speed up the…

Q: 4. The diagram below illustrates time dependent O₂ uptake by isolated skeletal muscle mito- chondria…

A: The mitochondrial respiration process involves the activation of the electron transport chain. The…

Q: Which process/es describe plant metabolism? O photosynthesis O Calvin cycle оо

A: The term metabolism describes all the chemical reactions involved in keeping the cells and organism…

Q: What are the three major pathways that eventually become entry points of molecules into the Krebs…

A: In the Krebs cycle, acetic acid or its equivalent provides energy to the organism through oxidation,…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…

A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…

Q: What are two important compounds that lie at crossroads of major metabolic pathways? Select both…

A: Metabolic pathway engineering in microbial hosts for heterologous biosynthesis of commodity…

Q: What does the last number in the numeric designation of enzymes refer to?

A: Each enzyme is allocated a four digit EC number,an enzyme Commission number does not specify enzymes…

Q: During glucagon signalling, one goal is to promote export of glucose from liver, In liver cells a…

A: Glucagon is a hormone secreted by the alpha cells in pancreas. It is a principle hormone that…

Q: Please describe the function of the Electron Transport Chain.

A: Electron transport chain: Electrons are used to release the energy, and form an electrochemical…

Q: nter

A: The OAT enzyme catalyzes the reaction of substrates ornithine and alpha-ketoglutarate to form…

Q: /hen the acetyl-CoA produced during B-oxidation in the liver exceeds the capacity of the citric acid…

A: The oxidation of some amino acids into fatty acids, as well as glycolysis, is the source of acetyl…

Q: a. We have a molecule 2,3-bisphosphoglycerate (BPG), which is a negative allosteric modulator for…

A: 2,3-Bisphosphoglycerate is a molecule formed through the Rapaport-Lubering cycle. The…

Q: the Km of an enzyme for its substrate tends to be close to the physiological (cellular)…

A: Enzymes are the biological catalyst which to increase the rate of reaction. Km is also called as the…

Q: Which of the following pairs of amino acids can have intermolecular hydrogen bonding between the…

A: The secondary structure of proteins is stabilized by hydrogen bonding. mainly it…

Q: One treatment for hyperuricemia is administration of xanthine oxidase inhibitors like  allopurinol.…

A: Hyperuricemia means a high concentration of uric acid in the blood. Hyperuricemia results in gout…

Q: malate dehydrogenase is interconverted into isozymic forms by oxidizing and reducing agents

A: Malate dehydrogenase is found in a variety of organs in vertebrates. It has been discovered that…

Q: Neutrophils exhibit a respiratory burst of free radicals and strong oxidizers during acute…

A: Free radicals are highly energetic chemical species that go onto react with almost anything.…

Q: Describe in detail the four levels of protein structure

A: Folding of protein is necessary for its biological activity. Protein folding occurs spontaneously,…

Q: What is the total number of ATP molecules that can be produced from the complete oxidation of one…

A:

Q: SARS-CoV (P SARS-CoV-2 ( 48 h G 1201 Cell- Cell- 100 I Percentage (%) 80 60- 40- 20- SARS-CoV (PV)…

A: Gluc activity was used as a waveform to evaluate the cell-to-cell and cell-free infectious disease…

Q: Propionic acid with a pk of 4.88 is a weak acid. Which situation is likely to occur in a propionic…

A: Introduction: The ionization constant (pKa) is a value that tells us the tendency of compounds or…

Q: Enumerate the 3 Coronavirus strains that caused a large-scale outbreak in humans in the past 2…

A: Coronaviruse is basically a group of RNA viruses that can causes the serious complication to birds…

Q: State the significance of HMP shunt

A: The pentose phosphate pathway is also called the hexose monophosphate shunt pathway.

Q: Long explanations are not needed.  True or False a. One NADH is produced for every pyruvate…

A: The pentose phosphate pathway is an alternative pathway for glucose oxidation. It provides NADPH for…

Q: Polysaccharide Chondroitin Heparin Hyaluronate Dermatan Sulfate Keratan Sulfate Mucin Unique Feature…

A: A polysaccharide is a large molecule composed of numerous smaller monosaccharides. Monosaccharides,…

Q: The compound below which is labelled in two positions with 13c (as represented by the shaded…

A: Glycolysis is a catabolic pathway in which glucose is oxidized to two molecules of pyruvate in the…

Q: In preparation of the ELISA plates, an albumin protein (BSA) was used to "block" the plate after the…

A: Introduction: Enzyme-linked immunosorbent assay is a quantitative immunological technique in which…

Q: Glycolysis is regulated primarily by _______________. a. three strongly exergonic, non-equilibrium…

A: The pathway that transform glucose to pyruvic acid is known as glycolysis. The free energy that is…

Q: 4. Enzymatic activity can be regulated by: (I) The molecular weight of enzyme molecule. (II)…

A: Tricarboxylic acid cycle,(TCA cycle) or Krebs cycle is the second stage in the three stage process…

Q: State those enzymes involved in tricarboxylic acid and explain each.

A: The tricarboxylic acid cycle (TCA cycle) is a common metabolic pathway located in mitochondrial…

Q: ATP constitutes the most common cellular energy currency. Explain the factors that account for the…

A: The human body comprises a trillions number of cells. Every cell comprises mitochondria. The main…

Q: Which of the following is NOT a fat soluble vitammin? O A O E D

A: Vitamins are the organic compounds required in small amounts for the maintenance of normal growth…

Q: Contrary to legend, camels do not store water in their humps, which consist of large fat deposits.…

A: Tripalmitoylglycerol is formed by three palmitoyl-CoA molecules.   As a result, it is required to…

Q: 9. Which of the following changes would not affect a peptide GENSHIN? A. Heat B. Inorganic Salts C.…

A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…

Q: What are the respective associated substances & processes? reduction regeneration RuBP RUBISCO NADPH…

A: Photosynthesis occurs in basically two steps and they are light reaction and dark reaction. In the…

Q: QUESTION 21 Consider the following template strand of DNA: AAT TCA CCC 3' 5 The mRNA made from this…

A: DNA stands for Deoxy-ribonucleic acid. It is a molecule which carries the information of a proteins.…

Q: Given the following results from qualitative tests performed on a sample, answer the succeeding…

A: Molisch's Test : This is the common biochemical test that performed to determine the presence of…

Q: In class, we described how germinating plant seeds can convert fatty acids to carbohydrates using…

A: Glyoxylate cycle - it is a variation of citric acid cycle. In this cycle, acetyl co A is converted…

Q: Which of the following statements are correct according to the article? Select one or more: O…

A: Introduction: Acetaminophen is a synthetic non-opiate derivative of p-aminophenol that is given…

Q: Analyte Results Reference ranges  total protein 9.40 g/dl 6.0 – 8.0 g/dl  albumin OD=0.09, []=? 3.7…

A: Solve it by using Lambert beers law. Which states that Absorption is directly proportion to…

Q: ACTIVITY 6.1 Complete the table below Source Example of Carbohydrate Function

A: Carbohydrates are a form of macronutrient that can be found in a variety of foods and drinks.…

Q: The helix of an A-DNA differs from the helix of a B-DNA in all of the following EXCEPT which phrase?…

A: DNA (deoxyribonucleic acid) is a type of nucleic acid, which acts as the genetic material. A-DNA,…

Q: Consider 1 molecule of the sucrose (monomeric units: glucose and fructose) that will undergo…

A: Disclaimer: Since you have posted a question with multiple subparts, we will solve first three sub…

Metabolic pathways

Metabolism is defined as the group of life-supporting, enzyme-mediated chemical reactions in organisms. A metabolic pathway is a set of these chemical reactions that involve anabolism (synthesis of complex biomolecules) and catabolism (breakdown of biomolecules into small molecules) that occur inside a cell. Metabolites are the reacting substances, products, and intermediate substances of an enzymatic process that are altered by a series of chemical events catalyzed by enzymes.