С 17 Based on the knowledge you gained from the cloning module, which of the bands in the figure is associated with the PCR insert after digestion of the plasmid? H
Q: ating, occasional clevated blood pressure and increased excitability. itional screening revealed a…
A: Introduction: Catecholamines are a monoamine organic compound that contains a catechol group and a…
Q: Question # 1: A shampoo bottle lists "partially hydrolyzed protein" as one of its ingredients. What…
A: Almost every hair product on the market today contains protein in some way or another. Protein…
Q: . This cell is dependent solely on glucose as an energy source a.Muscle cells b.Kidney cells…
A: 1. the cell that solely dependent on glucose source is- Answer- d. brain cells Glucose in human…
Q: In your own understanding, what do you think is/are the reason why most of the clinical features of…
A: Deficiency disease is described as a type of disease that is majorly caused due to the lack of some…
Q: What is the role of the substrate? Is it really necessary to add substrate in ELISA?Explain why, or…
A: The antibodies that can specifically bind to an antigen can be used for the detection of the…
Q: 1.Promoters usually contain an AT-rich sequence. How is this beneficial to transcription?
A: Promoter is a specific site upstream of a gene where RNA Polymerase binds and initiates the process…
Q: Based on the observations below, make a brief statement on the identity of the sample. Test…
A: Introduction: Carbohydrates are an important source of energy used by all living things. It serves…
Q: B-oxidation of a molecule of palmitate (i) requires water (ii) requires NADH (iii) produces NADPH
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Which of the following molecules is NOT produced in pentose phosphate pathway? O A. CO2 ОВ. АТР O C.…
A: Since there are multiple questions and which question is to be solved has not been specified, as per…
Q: Velocity (mM/min) [S], mM Uninhibited Inhibited 1.75 1.94 1.38 2.17 2.26 1.67 3.00 2.85 2.13 5.50…
A: Enzyme kinetics are studied using Michaelis Menten equation. This equation is as below: V = VmaxSKM…
Q: In Figure 4C, we see the inhibition of LRRK2 kinase activity by nanobody 1 (Nb1). Using the…
A: The Lineweaver-Burk plot is used for calculating the Vmax and the Km values in the enzyme kinetics…
Q: ACTIVITY 6.2.4 Give the systematic name of the following cyclic monosaccharides: 1. Name: OH Н OH Н…
A: Monosaccharides are carbohydrates with single sugar unit. The structure of monosaccharides can be…
Q: Buffer systems can absorb hydrogen ions from the blood to increase pH into homeostatic range (pH:…
A: The maintenance of pH within the body is necessary since most enzymes have a range of pH under which…
Q: To establish a standard curve for a BSA standard curve using Bradford, the spectrophotometer…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. These…
Q: Which of the following is NOT a major source of protein? A. fish B. Milk C. Egg D. Rice
A: Introduction: Proteins are organic substances and polymers of amino acids. The elements present in…
Q: Complete table 2. * Since you were not able to conduct an actual experiment on these tests, kindly…
A: Bromine test is a qualitative analysis of organic chemistry to detect unsaturation, anilines and…
Q: Acidosis is a human body disorder caused by too much acid in the stomach. If a patient was tested…
A: Acidosis is a condition in which the body's fluids contain an abnormally high level of acid. It is…
Q: Match each Sl unit to the quantity it measures. degree Fahrenheit second gram kelvin nanosecond…
A: A unit of measurement is a conventionally defined magnitude of a quantity, that is used as a…
Q: Predict which fractions will contain actin and which will contain myosin, and predict the degree of…
A: All types of muscle tissue contain actin and myosin. Muscle contractions and movements are…
Q: Table Q1(a) shows typical values for the intracellular and extracellular concentrations of the major…
A: All cells have an electrical potential difference or membrane potential across their plasma…
Q: ______ 1. is the name of the enzyme that catalyzes the hydration of carbon dioxide to bicarbonate…
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. The CO2 formed in the…
Q: Which of the following best describes the mechanism of action of a cardiac glycoside? A)…
A: Cardiac glycosides are the compounds that are important for enhancing the force of heart to increase…
Q: Draw the Haworth Projection or the cyclic structure of the following:
A: organic compound organized in the form of aldehydes or ketones with multiple hydroxyl groups coming…
Q: + H2O NH + HCO,- NH, Urea a. =NH HN =NH HN H2O + HCO,- H2N `CO, H,N b. L-Histidine L-Histamine c.…
A: Hi. Thank you for the question, As per the honor code, we are allowed to answer three sub-parts at a…
Q: What type of DNA changes are revealed from p.Gln39X mutation. Is it pathogenic?
A: Introduction: Mutations are the change in the nucleotide sequence of DNA. It may occur in somatic…
Q: What are the three major pathways that eventually become entry points of molecules into the Krebs…
A: In the Krebs cycle, acetic acid or its equivalent provides energy to the organism through oxidation,…
Q: Which of the two carbon sources, glucose or acetate, is more advantageous for the cultivation of…
A: E.coli - Escherichia coli, it requires a carbon source to grow to serve as substrate for the…
Q: What is phenylketonuria? Discuss its occurrence, symptoms if any, treatments if there are, and any…
A: The pattern of inheritance of a condition caused by a recessive faulty gene copy located on an…
Q: (a) What is the function of helicase in DNA replication? (b) What is the function of DNA polymerase?…
A: DNA is called deoxyribonucleic acid. DNA act as genetic material in most organisms. DNA replication…
Q: What is the effect of a defective a(1→ 4) phosphatase in Pompe's disease (GSD II)? O Accumulation of…
A: Glycogen Storage Disease type II , also called Pompe's disease occurs to due to the deficiency of…
Q: discuss the biosafety issues involved in the use of genetically engineered microorganism.
A: Biotechnology or genetic engineering where organisms including plants, animals and bacteria or…
Q: In your own words, discuss the phenomena occur during the resting state and active state until the…
A: Neurons are the basic structures and functional units of the nervous system. The axon or the nerve…
Q: Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…
A: Answers Image A - The given image is a Purine Nucleoside. It has deoxy ribose sugar molecule in it.…
Q: d. Rise in levels of ADP Circle one: Increase rate of glycogenolysis Decrease rate of glycogenalysis…
A: Glycogenolysis is a biochemical pathway in which glycogen breaks down into glucose-1-phosphate and…
Q: Ön average, 180 liters of plasma are filtered each day. A If humans had to expend one molecule of…
A: Introduction: A mole of any substance contains as many elementary units (atoms and molecules) as the…
Q: tफकाटक ननी वकट नवींणणणणय हैमकजनाययळे प्B fAtzeorgating a) it is mare highly hydrated. are pressture…
A: The hydrophobic interaction is critical for the stability of several bioactive systems and plays a…
Q: The reason for the decrease in the rate of enzyme reaction as the temperature is increased beyond…
A: An enzyme is a substance which serves as a catalyst in living things, governing the rate of chemical…
Q: In the absence of oxygen, what would happen to a cell that performs aerobic cellular respiration? O…
A: There are two type of cellular respiration.One is aerobic cellular respiration and other is…
Q: Explain what hydrogels are as a group of material. Discuss and illustrate with examples the most…
A: Large molecules which are synthetically made or obtained naturally and are made up of many simpler…
Q: 3. Give the specific enzyme class and first two digits of the enzyme's EC number for each…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: 38. "The sterol is a precursor to all compounds except" A.ergosterol B.testosterone C.bile salts…
A: We'll answer the first question since the exact one wasn't specified. Please submit a new question…
Q: Regarding pathways that feed glycolysis, which of the following statements is false? Mannose is also…
A: The glycolytic pathway metabolizes glucose molecules to synthesize energy in the form of ATP and…
Q: An inhibitor "I" is added to the enzymatic reaction at a concentration of 1.0 g/L. The data obtained…
A: The reciprocal kinetic data is as follows: 1/[S] L/g 1/V (min-L/g) E = 0.015 g/L (Without…
Q: hich of the following play an important role in synthesis of DNA/RNA: a.B-12 b.Folic acid c.Sodium…
A: The RNA is synthesized by RNA polymerase enzymes from a DNA template through DNA transcription.…
Q: Differentiate osmosis from active transport. requires movement is protein according to channels…
A: The plasma membrane of the cell is selectively permeable. It forms the barrier that blocks the free…
Q: Answer choices : 0.3% gel OR 1.0% gel Explanation Choices : Agarose makes smaller pore sizes which…
A: agarose gel electrophoresis is widely used to resolve DNA fragments. DNA fragments migrate accorsing…
Q: Discuss the four main mechanisms of antibiotic resistance and factors that promote the emergence of…
A: Antibiotic resistance occurs when microorganisms like bacteria and fungi develop the ability to…
Q: Compare and contrast some of the artificial sweeteners:aspartame,saccharin, sucralose, erythrol
A: Artificial sweeteners are used for sugar replacements. This sweetener provides a sweet taste to…
Q: Which of the following describes the correct order of energy conversions necessary to form…
A: Bioenergy is described as one of the most crucial resources that are available in order to meet the…
Q: 8. A paticnt sullering from infectious polyarthritis, has been reeciving prednisone for a long time…
A: Prednisone is a kind of glucocorticoid. It is a prodrug, which means the liver converts it to…
please help
Step by step
Solved in 2 steps with 1 images
- A genomic DNA library is made by using _____ to cut the target genome into small fragments, which are then amplified by PCR and ligated into plasmids.Which is the odd one out ? For the rest, explain the concept/process/technique they are involved with. polymerase primers DNA RNA topoisomeraseUsing the plasmid map of pBCH2.0 calculate the length of the shortest DNA fragment if this plasmid was digested with the restriction enzymes PstI and EcoRV.
- For which of the following would not require a nucleic acid probe?a. locating a gene on a chromosomeb. developing a Southern blotc. identifying a microorganism with FISHd. constructing a recombinant plasmidYou isolated a 10,500 base pair plasmid (supercoiled, cccDNA) from E. coli. The plasmid contains one unique recognition site for EcoRI, a restriction enzyme. Restriction enzymes recognize a specific sequence and cut both strands of the DNA at that sequence (Chapter 7). Brief DNase I treatment breaks one (or very few) phosphodiesterbonds in each DNA molecule, leaving the double-stranded DNA with one strand broken but the other strand intact, i.e “nicked.” You briefly incubated the cccDNA at 37°C in four separate reactions containing the components listed below. You ran each reaction sample on an agarose gel and visualized the DNA using ethidium bromide and UV light. The reactions included the appropriate buffer and ATP when required. An agarose gel containing four lanes of possible products is given below. Please refer to Figs. 4-26 and 4-27 in Watson for reference. For each reaction, indicate which lane of the gel contains the products that you would expect to see on your…Entire sequence below needs to be amplified by PCR and subcloned into a plasmid vector. Which of the primer sequences listed underneath is the correct reverse primer. What is the correct sequence 5'ATCTCTATTTAATATTTATGTCTATTTAAGCCTCATATTTAAAGACAGGGAAGAGCAGAACGGAGCCCCAGGCCTCTGTGTCCTTCCCTGCATTTCTGAGTTTCATTCTCCTGCCTGTAGCAGTGAGAAAAAGCTCCTGTCCTCCCATCCCCTGGACTGGGAGGTAGATAGGTAAATACCAAGTATTTATTACTATGACTGCTCCCCAGCCCTGGCTCTGCAATGGGCACTGGGATGAGCCGCTGTGAGCCCCTGGTCCTGAGGGTCCCCACCTGGGACCCTTGAGAGTATCAGGTCTCCCACGTGGGAGACAAGAAATCCCTGTTTAATATTTAAACAGCAGTGTTCCCCATCTGGGTCCTTGCACCCCTCACTCTGGCCTCAGCCGACTGCACAGCGGCCCCTGCATCCCCTTGGCTGTGAGGCCCCTGGACAAGCAGAGGTGGCCAGAGCTGGGAGGCATGGCCCTGGGGTCCCACGAATTTGCTGGGGAATCTCGTTTTTCTTCTTAAGACTTTTGGGACATGGTTTGACTCCCGAACATCACCGACGCGTCTCCTGCTG 3'
- Explain the role of each of the two enzymes used in the room temperature -PCR process. Reverse transcriptas Taq DNA polymeraseA linear DNA fragment and a plasmid has three restriction sites for EcoRIhow many fragments will be produced from linear DNA and plasmid respectively.With reference to the image below, discuss the process and principle involved for screening/selection ofhosts (last stage of cloning) containing the intended recombinant plasmid.
- Plasmids are very important for recombinant DNA work. 1.) Describe the components that are important to a cloning vector.You are on a research project to study rice. Your want to use reverse transcription PCR to amplify the OsMEI28 cDNA from the plant and create a plasmid that contains the cDNA sequence in a vector. Briefly describe the steps that you would need to take.A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. He knows that the nucleotide sequence of a small part of the gene is CTCGACTCACA. Briefly explain how to obtain the desired gene. Briefly describe how to clone the desired gene into a cloning plasmid.
