List and describe the sequential steps of TRANSLATION in prokaryotic (bacterial) cells. Don’t be too detailed, but provide enough information about the key steps.

Q: List two essential roles of ribosome during translation.

A: The ribosomes are important cellular organelles, found within all living cells that perform…

Q: Which of these statements is true about the elongation step of translation? O The growing…

A: Translation is the process by which the triplet base sequence of an mRNA guides the linking of a…

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: compare and contrast prokaryotic from eukaryotic translation. Expound on at least three differences.

A: Introduction Translation:- It is the process by which a cell makes proteins using the genetic…

Q: Describe all the elements required to carry out the process of translation.

A: What is translation Translation refers  to the process of polymerization of amino acids to form a…

Q: Name and describe in DETAIL the three steps of translation.

A: Polymerization of amino acids to generate a chain of polypeptides is known as translation.…

Q: Explain the functional roles of the A, P, and E sites during translation.

A: In molecular biology, translation is a process in which ribosomes in the cytoplasm or endoplasmic…

Q: Which of the following is not directly involved in translation?

A: Translation is the cycle where ribosomes present in the cytoplasm or endoplasmic reticulum blend…

Q: Arrange the following components of translation in the approximate order in which they would appear…

A: In prokaryotes, the protein synthesis takes place in the cytoplasm. It comprises two steps…

Q: In a detailed diagram show and explain all the locations where RNA may regulate protein translation.…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Q: How does initiation of translation occur in prokaryotes? Include a discussion of the ribosomal…

A: Like transcription, the process of translation also involves three successive stages- initiation,…

Q: Contrast the roles of tRNA and mRNA during translation, and list all enzymes that participate in the…

A: Ribonucleic‌ ‌acid‌ ‌(RNA)‌ ‌‌also‌ ‌contains‌ ‌genetic‌ ‌material‌ ‌but‌ ‌rarely‌ ‌takes‌ ‌part‌…

Q: Compare and contrast bacterial and eukaryotic translation.

A: The central dogma of biology explains the flow of information from genes to protein by two…

Q: For each of the following initiation factors, how would eukaryoticinitiation of translation be…

A: Initiation factors are a kind of proteins, which bind to the smaller subunit of the ribosome. This…

Q: plain the steps of translation. Include all molecules involved in the process and their role in the…

A: Every cell has a nucleus that houses genetic material, DNA.  Genes are the segments of…

Q: Explain where the energy comes from for the peptide bond formation during translation

A: The translation is the biochemical process of the synthesis of the polypeptide chain of amino acid…

Q: Describe the steps (Initiation, Elongation and Termination) involved in translation of mRNA to…

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: Explain the elongation steps in bacterial translation

A: The translation is defined as the conversion of mRNA into proteins. The nucleotides in the group of…

Q: Please describe the four-step process of the elongation during protein translation in bacteria.

A: Translation is  the process of formation of proteins from mRNA with the help of ribosomes in the…

Q: The process of translation involves three distinct phases: initiation, elongation, and termination.…

A: Translation is the process by which a protein is synthesized from the information contained in a…

Q: Use the numbers below to indicate the correct order of events (from left to right) during the…

A: Hi, Thanks For Your Question.  Answer : Correct Sequence Is 3 4 2 1 5.

Q: Describe what is happening at each of the four stages of translation shown in the above diagram-

A: The translation is a process by which the genetic code contained within a messenger RNA molecule is…

Q: Compare and contrast the process of protein synthesis in bacterial and eukaryotic cells, giving…

A: The central dogma of biology explains the flow of information from genes to protein by two…

Q: Given the following mRNA sequence, write the peptide sequence that will result from protein…

A: mRNA stands for messenger RNA( Ribonucleic acid).  Protein translation is a process of making…

Q: Compare transcription to translation.  Which of the process is mostly related to errors?

A: Transcription vs Translation Initiation- The transcription process is the beginning of the gene…

Q: Describe the key steps of translation

A: Translation is the process of polymerization of amino acids to form a polypeptide. The order and…

Q: Give an overview of the process of translation in prokaryotes with at least 10 bullet points.

A: Translation: Synthesis of protein from the mRNA. Polypeptide synthesis direction - N - C terminus

Q: Explain the difference between transcription and translation and how the processes differ in…

A: Central dogma explains how genetic information flows within the organism. It states that DNA makes…

Q: Discuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it…

A: Ribosomes are present in both plant and animal cells. they are present in both prokaryotic and…

Q: Using the given information, determine the correct order of the following events during translation:

A:

Q: Describe the steps that occur during the initiation, elongation, and termination stages of…

A: The translation is defined as the conversion of mRNA into proteins. The nucleotides in the group of…

Q: Describe some of the ways that the initiation step of translation differs from the elongation steps…

A: The principle of protein folding substantiates that all the data needed for a protein to correctly…

Q: Arrange the following components of translation in the approximate order in which they would appear…

A: Translation is the process of synthesis of proteins from the mRNA using special type of RNA called…

Q: Describe the prokaryotic translation initiation shown in the diagram. Define the convention of…

A: In bacteria initiation factor are required .Initiation factor 3(IF3) prevents 30S subunit binding to…

Q: Briefly describe translation?with examples.

A: Genetic information of an organism is secured in the DNA (or RNA, in certain viruses). It may be…

Q: Give the elongation factors used in bacterial translation and explain the role played by each factor…

A: Protein synthesis involves in three stages: initiation, elongation, and termination. Elongation is…

Q: Consider the events that occur throughout the three critical stages of translation.

A: Asked : Events that occur throughout the three critical stages of translation.

Q: Describe the key steps of translation, indicating howeach depends on the ribosome.

A: The central dogma of biology explains the flow of information from genes to protein by two…

Q: Compare and contrast TRANSLATION in prokaryotes and eukaryotes

A:

Q: Which of the following statements about bacterial translation is FALSE? O A. The arrangement of key…

A: A)  The ribosomes have the two subunits of the rRNA and the proteins, a large subunit with the three…

Q: Which of the following statements about how cells control the size of the poly-A tail on mRNA…

A: The mRNA or the messenger RNA is the pre-RNA which is derived from the DNA during transcription. The…

Q: Why is it necessary for an in silico translation tool to provide 6 different frames of the…

A: The open reading frame or the ORF is the gene region that can get translated by the translational…

Q: Which of these statements is true about the elongation step of translation? The growing polypeptide…

A: Translation is the process of translating the sequence of a messenger RNA  molecule to a sequence of…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.