Microtubules in an animal cell: O a undergo assembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to vinblastine O b. undergo disassembly if the concentration of GDP-bound tubulin dimers is high and a cell is exposed to taxol O c. undergo disassembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to colchicine O d. undergo assembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to colchicine

Microtubules in an animal cell: O a undergo assembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to vinblastine O b. undergo disassembly if the concentration of GDP-bound tubulin dimers is high and a cell is exposed to taxol O c. undergo disassembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to colchicine O d. undergo assembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to colchicine

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter6: Cell Communication

Section: Chapter Questions

Problem 4TYU

See similar textbooks

Similar questions

26.With regard to cell signalling, which of the following do not represent exogenous signals? A. Neurotransmitters B. Invading microorganisms C. Light D. Odours E. All of the above statements are correct 27.Which of the following statements correctly describe distinct aspects of microtubule dynamic instability? A. αβ-tubulin dimers must contain GTP bound to both subunits to be added to a microtubule B. Terminal β-subunits have essentially negligible rates of GTP hydrolysis C. The addition of a new αβ-tubulin dimer to a growing microtubule results in GTP hydrolysis within the formerly terminal β-tubulin subunit D. The end of each microtubule has a cap of GTP-bound β-subunits, with the central region of the microtubule primarily consisting of GDP-bound β-subunits E. All of the above statements are true 28.All of the following statements regarding myosin are true, with the exception of: A. Myosin is a multimeric protein made up of heavy and light chains B.…
Certain hormones, such as epinephrine, can increase the levels ofcAMP within cells. Let’s suppose you pretreat cells with or withoutepinephrine and then prepare a cell extract that contains theCREB protein.You then use an electrophoretic mobility shift assay to analyzethe ability of the CREB protein to bind to a DNA fragmentcontaining a cAMP response element (CRE). Describe what theexpected results would be.
Yeast cells are eukaryotes, and they require a functional secretory pathway to grow and to maintain cellular organization. But surprisingly, when SRP is removed from yeast cells by deleting the relevant genes, the cells are still alive (although they grow slowly). a) How can yeast survive without SRP? Propose two alternative hypotheses. b) How might electron microscopy of normal and SRP-deficient yeast cells help you to distinguish between these two hypotheses?
6. "Coated pits" are formed as a result of a. clathrin triskelions polymerizing of the surface of secretory vesicles b. clustering of v-SNAREs on the surface of the plasma membrane c. endocytosis of ER resident proteins carrying the KDEL sequence d. clustering of cell surface receptors bound to their ligands e. acidification of late endosomes.
After the initial Actualization of the Cit+ phenotype, there was another alteration to the A-3 genome that resulted in increased growth (e.g. Refinement). What explained the increase in growth rate in response to Refinement? A. Increase number of transporters localized to the plasma membrane. B. Increased ability to metabolize glucose. C. Increased citric acid cycle activity. D. Altered promoter activity resulting in constitutive gene expression.
The affinity of integrins for matrix components canbe modulated by changes to their cytoplasmic domains:a process known as inside-out signaling. You have iden-tified a key region in the cytoplasmic domains of αIIbβ3integrin that seems to be required for inside-out signaling(Figure Q19–3). Substitution of alanine for either D723in the β chain or R995 in the α chain leads to a high levelof spontaneous activation, under conditions where thewild-type chains are inactive. Your advisor suggests thatyou convert the aspartate in the β chain to an arginine(D723R) and the arginine in the α chain to an aspartate(R995D). You compare all three α chains (R995, R995A,and R995D) against all three β chains (D723, D723A, andD723R). You find that all pairs have a high level of sponta-neous activation, except D723 vs R995 (the wild type) andD723R vs R995D, which have low levels. Based on theseresults, how do you think the αIIbβ3 integrin is held in itsinactive state?
Genetic testing of a 29-month-old boy shows a mutation in the Phe residue at position 508 in the cystic fibrosis transmembrane conductance regulator (CFTCR) gene. Cultured skin fibroblasts from the boy contain an abnormal form of CFTCR protein bound to ubiquitin. Which of the following structures is the most likely site of elimination of these abnormal proteins in this patient? A) Endoplasmic reticulum B) Endosome C) Golgi complex D) Lysosome E) Proteasome
A rare mutation can result in eukaryotic cells that causes a failure in the cell to synthesize the Signal Recognition Particle (SRP). Failure to make the SRP would impact protein synthesis by ________ . A. Preventing transition of bound ribosomes to free ribosomes B. Preventing binding of ribosomes to the rough ER during synthesis of proteins with a signal sequence C. Preventing export of mRNA out of the nuclear envelope D. Preventing binding of ribosomes to the smooth ER during synthesis of proteins with a signal sequence
In a lysosomal storage disease, newly synthesized lysosome hydrolases are secreted from the cells rather than being delivered to the lysosomes. From the list below, what is the most likely reason? Please EXPLAIN. a) The cis-Golgi network lacks a proton gradient b) The ER is unable to produce lysosomal vesicles c) Lysosomal enzymes are not phosphorylated in the rER d) Mannose is not phosphorylated in the cis-Goligi network e) All the hydrolase genes are mutated, resulting in synthesis by ribosomes free in the cytoplasm rather than on the endoplasmic reticulum membrane Give typing answer with explanation and conclusion
Experiment The effect of starvation on protein synthesis in Caenorhabditis elegans was studied in this experiment. Worms were kept well fed (C, control) or starved (S) for 6 hours. Ribosomal fractions were isolated from the two groups and centrifuged in separate tubes through 15-60% sucrose density gradients. Fractions were collected from the top of the sucrose gradient. UV absorption at 260 nm (OD260) was measured (A), and RNA isolated from each fraction was analyzed by agarose gel electrophoresis (B).
Melanosomes are specialized lysosomes that storepigments for eventual release by exocytosis. Various cellssuch as skin and hair cells then take up the pigment, whichaccounts for their characteristic pigmentation. Mousemutants that have defective melanosomes often have paleor unusual coat colors. One such light-colored mouse, theMocha mouse (Figure Q13–3), has a defect in the gene forone of the subunits of the adaptor protein complex AP3,which is associated with coated vesicles budding from thetrans Golgi network. How might the loss of AP3 cause adefect in melanosomes?
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair