missense mutation: D Adds a base OProduces a different amino acid O Deletes a base O Causes a premature stop in translation QUESTION 32 lucleotide excision repair: O Requires photolyase O Repairs thymine dimers O Connects fragments of DNA O Is a proofreading mechanism

Q: Vhich type of mutation occurs when a DNA sequence changes from GGA TCA CCG GAA... to GGA TCG CCG…

A: Step 1: A mutation is a change in our DNA sequence that occurs as a result of errors during DNA…

Q: The diversification of RNA building blocks through chemical modification...: O...decreases the…

A: RNA is the ribonucleic acid, which is a type of nucleic acid, the other one is DNA or…

Q: Normal sequence: DNA: MRNA: GGA CCU prline CTC GAG glutamic acid CTC GAG glutamic acid Amino Acids:…

A: Normal sequence:  DNA: GGA CTC CTC  mRNA: CCU GAG GAG Amino Acids: proline glutamic acid glutamic…

Q: A mutation in which one nitrogenous base is substituted for another.. O never occurs in eggs or…

A: At a specific gene locus, a change in the typical DNA sequence. Although the term has a negative…

Q: Which of the following processes is dependent primarily on exonuclease activity? O Mismatch repair O…

A: The exonuclease selected is subject to which side of the jumble MutH etches the strand – 5' or 3'.…

Q: 39 The Central Dogma describes the flow of genetic information as follows: Select an answer and…

A: DNA are genetic material  which consist of genetic information that needs to passed from one…

Q: DNA DNA Leading strand mRNA tRNA Amino Acid A T G         A A A         G T C         A T…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: Review translation. Which step is not a part of elongation cy O binding of small ribosomal unit to…

A: Translation : It is the process which involves formation of proteins from mRNA and ribosomes .  This…

Q: During DNA replication, the Okazaki fragments are Select one: O a. single-strand RNA O b. RNA-DNA…

A: Option c

Q: Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of…

A: Any detectable, inheritable qualitative or quantitative change in genetic material of an organism…

Q: DNA Sense G C A strand DNA Antisense TAC T strand AUG MRNA codon U TRNA anticodon Amino acid…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: Original DNA Sequence: T A C A C C T T G G C G A C G A C T …  mRNA Sequence:  Amino Acid Sequence:

A: CENTRAL DOGMA-  Replication is the process when DNA replicates itself means it will make copies of…

Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…

A: Mutation is defined as the change in the nucleotide sequence of DNA.

Q: Directions: Transcribe the DNA sequence in the space provided. Use your notes and what you know.…

A: Transcription  A process of making of mRNA from DNA. mRNA contain information about polypeptide…

Q: Translate this DNA sequence using Genetic Code 5' - ATG GGG cCC GTC CAT CCG TAC GCC GGA ATT ATA - 3'…

A: DNA is transcribed into mRNA through the process of transcription. mRNA is then translated into…

Q: A mutation in which one nitrogenous base is substituted for another. O never occurs in eggs or sperm…

A: Mutations are new sudden inheritable discontinuous variations which appear in the organisms due to…

Q: Codons are recognized by O DNA polymerase and a codon O FRNA and a codon O TRNA and an anticodon O…

A: Codon is a sequence made of DNA or RNA which corresponds to a particular amino acid.Genetic code is…

Q: The template strand of a segment of double-helical DNA contains the sequence –…

A: Introduction: DNA is a type of nucleic acid present in the nucleus of the cell. It is the genetic…

Q: Whatis the purpose of the dideoxynucleotides in DNA sequencing? OCH2 base - OCH2 base H. H. H. H. H.…

A: ddNTP(dideoxynucleotide triphosphate) used in sanger dna sequencing .which terminate the…

Q: The bisulfite sequencing is different from regular sanger sequencing of nucleotides because…

A: The Sanger sequencing is also known as the chain termination method, it is a method used to…

Q: Which structure is responsible for translating MRNA? O a. RNA Polymerase II O b. RNA polymerase I O…

A: Introduction Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that corresponds to…

Q: PART C. Use your codon chart to determine the amino acid sequence. Remember to read through the…

A: the three-letter genetic code is the way by which the cell transcript the information from DNA to…

Q: Transcription is a process in which MRNA is synthesized from DNA. MRNA is pro duced from only one…

A: Gene is the sequence of nucleotides that encode a protein. This protein has specific function.

Q: Bēlöw is thế TEMPLATE strand of DNA for a particular gene. Template strand: 5' AATCАTAAСТСАТTG 3' A.…

A: The two types of strands in DNA are coding (non-template) and template (non-coding). Both strands…

Q: Show the effect of the following types of mutation on the 5th N-base of the given DNA sequence. Use…

A: A missense mutation is a mistake in the DNA which results in the wrong amino acid being incorporated…

Q: is a single stranded RNA molecule held together by hydrog bonds. Answer: MRNA Which of these DNA…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: Silent mutation: Single substitution mutation when the change in the DNA base sequence results in a…

A: A mutation is defined as the change in the sequence of DNA of a cell in organisms or viruses. These…

Q: 5 T G T T A G T C G A A T 3  what is the complimentary dna and complimentary mRNA

A: DNA is genetic material which consists of two types of strands . A ) Template strand  B ) Coding…

Q: Determine what amino acid will be formed from the given DNA strand below:…

A: Determine what amino acid will be formed from the given DNA strand below:…

Q: is the term used to describe the genetic code because there is more than one codon that specify for…

A: 7. Denaturation is the process of separating two DNA strands into two single strands.  Therefore…

Q: TRANSCRIPTION a) polypeptide TRANSLATION a) MRNA b) both strands of DNA c) TRNA d) one strand of DNA…

A: For replication, we require both strand of DNA that will act as template stand for bi-directional…

Q: In which direction does RNA polymerase elongate a strand of RNA? O 3' to 5' 5' to 3' Both 5' to 3'…

A: During elongation , RNA polymerase elongate a strand of RNA in 5' to 3' direction. RNA polymerase…

Q: Below is a segment found in the DNA template strand of a gene for a structural protein. This section…

A: The abrupt changes in DNA sequence of nucleotides is called mutation. It may or may not change the…

Q: Which mutation that would result to a change of amino acid in the polypeptide? missense mutation…

A: When a DNA gene is destroyed or mutated in such a way that the genetic message carried by that gene…

Q: Use the images to identify the amino acid sequence with the following DNA sequence (hint: transcribe…

A: DNA is transcribed to form mRNA. This mRNA is used as a codon for the formation of amino acid…

Q: following is a series of DNA triplets. first, transcribe the correct complementary sequence of mRNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: anslation is synthesis of proteins from: t-RNA A. B. C. D. m-RNA r-RNA DNA 41. It is a type of…

A: *We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: In DNA one strand runs "upside-up" while the other one runs in the opposite direction, "upside-down"…

A: The deoxyribonucleic acid (DNA) is the genetic material that consists of all the information…

Q: Select the CORRECT sequence of sites that are involved in translation. A site, P site, E site E…

A: Translation is the process by which mRNA is used in the synthesis of a protein. Protein synthesis…

Q: Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA…

A: Transcription is the process where the genetic information on the DNA strand is transferred into an…

Q: Which mutation changes a normal codon to another codon specifying the same amino acid a. directed b.…

A: Any change in the base pair of the sequence of base pairs that are present in the nucleic acid…

Q: Evaluate the mutation below. Original DNA strand: 3'-TACTTACGCACGGCCACT-5' Amino acids produced:…

A: From the DNA sequence the mRNA is produced within the nucleus of the cell by the transcription…

Q: At the DNA level, a mutation in a protein coding region where a single base is replaced by another…

A: Mutation is the abrupt change that occurs in the sequence of DNA resulting In altered phenotype.…

Q: Which of the following provide clues that a particular DNA sequence is part of protein-coding gene?…

A: A protein-coding gene is a DNA sequence that instructs the cell to create a specific protein.…

Q: Which type of mutation is most likely to be silent? An inversion A deletion An insertion A…

A: Mutation is the random change in the sequence of nucleotides of a gene.

Q: DNA Sequence:     TAC  TCC  GGC  TCT  CCC  AGT  TGA  ACT Mutated Sequence: TAC TCG  GCT  CTC  CCA…

A: A mutation is a change in an organism's, virus's, or extrachromosomal DNA's nucleotide sequence. DNA…

Q: Shown below is a DNA coding strand. A base (*G*) mutates to Adenine (A). What will be the resulting…

A: In this question, we are given a coding strand of DNA which has undergone mutation from *G* to A. A…

Q: Provided below are strands of DNA. The first one has been done for you. First transcribe the code…

A: Answer: CENTRAL DOGMA = It is the complete process of replication of DNA , transcription of RNA ,…

Q: Туре of mutation: Effect: protein/ amino acid Original Altered sequence sequence DNA nucleotide MRNA…

A: A mutation is a change in the nucleotide sequence of an organism's genetic material (genome).…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.