Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read? Edit View Inscrt Format Tools Table

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′Make a drawing.

A: RNA stands for ribonucleic acid. It is a complex compound comprising of high molecular weight and…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: Protein is made up of a chain of monomeric subunits called amino acids joined together by peptide…

Q: Complete the following chart. Region Length Multiples of 3?

A: RNA is abbreviated as ribonucleic acid and it is composed of a ribose sugar, which is attached with…

Q: What kind of mutation is present in the following DNA strand?: Wild-type: 3'-AGTCCCTGAAAT-5'…

A: Introduction : Mutation is defined as a change in the DNA sequence. Mutation is an alteration that…

Q: Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid…

A: Ribonucleic‌ ‌acid‌ ‌(RNA)‌ ‌‌also‌ ‌contains‌ ‌genetic‌ ‌material‌ ‌but‌ ‌rarely‌ ‌takes‌ ‌part‌…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:

A: This question is based on the functioning of mRNA expression.

Q: Below is a sequence of DNA.…

A: The process of identifying the coding region and the position of a gene in a genome is known as gene…

Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Q: Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of…

A: Any detectable, inheritable qualitative or quantitative change in genetic material of an organism…

Q: Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the…

A: Protein consists of amino acids.

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: DNA 5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand 3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding…

A: The mRNA is produced by the process of transcription. And protein is produced by the process of…

Q: Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about…

A: Introduction: 20 amino acids make up all the proteins. These are the building blocks of proteins…

Q: Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3…

A: According to Bartleby guidelines,  we are supposed to answer first three subparts in case of…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: The DNA is composed of purines and pyrimidines. The purines in DNA are adenine and guanine. The…

Q: BamHI Haelll Both 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb Figure 2 How long is the original DNA molecule?

A: If it is a closed circular DNA, BamH1  cut it into three fragments of length 10kb 5kb 2kb

Q: Which one of the following options would be a good way to identify the location of the poly A tail…

A: Pre mRNA undergoes several post-transcriptional modifications. One of these modifications is…

Q: Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand…

A: A gene mutation that results from the substitution of one base pair of another. TATGAAAGT non…

Q: The following DNA sequence is part of one exon and contains the beginning of a gene’s open reading…

A:

Q: Second letter UUU Phenyl- UUC alarine UGU UGC Cysteine UAU UCU UCC UCA UCG UAC yrosine Serine UUA…

A: Mutation of amino acids change the primary structure of the protein which affects the protein…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: Melting temperature is the temperature at which a double-stranded molecule of DNA is broken down…

Q: A. The insertion shifts the reading frame to the right. The deletion frame shifts the reading frame…

A: 1) DNA Sequence: THE BOY CUT HIS LIP AND ARE THE HOT DOG Insertion: THE BOY CCU THI SLI PAN DAR ETH…

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA.…

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results…

Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Add an A before codon 3 or delete the middle base in…

A: A frameshift mutation occurs in the DNA sequence due to either addition or deletion of DNA bases…

Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…

A: Introduction  The process by which the genome's DNA is copied in cells is known as DNA replication.…

Q: Complete the table below: DNA DNA Complimentary Strand  mRNA sequence  tRNA sequence  Amino…

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sense strand sequence shown above, identify the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Below is a small stretch of DNA in the middle of a gene. What amino acid sequence would be encoded…

A: Amino acids are the organic compounds that contain amino group and carboxyl group functional groups…

Q: Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING:…

A: The template strand is from 3` 5` and a coding strand of DNA is from 5` to 3`. The synthesis of m…

Q: Use the codon wheel on page 10.11 to identify any stop codons in the stop codons. Use the codon…

A: During transcription process RNA is formed with the help of complementary base pairing with template…

Q: CGG CCA UGU AUA UAA Enter your answer as a string without dashes, using three-letter abbreviations…

A: DNA ( Deoxyribonucleic acid) is a ladder like helical structure which serves as genetic material in…

Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: Transcription is the process by which RNA is synthesized from DNA. The genetic material is…

Q: The sequence of a polypeptide is determined by the order of codons that specify the amino acids in…

A: Proteins are the ultimate products of the genes. DNA is transcribed into m RNA and this is…

Q: 3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T…

A: Since we are entitled to answer first question, we’ll answer the question 3 as you have not…

Q: DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!)       tRNA anticodon (No thymine in…

A: According to Bartleby guidelines, the first three questions have been answered. Kindly post the…

Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…

A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…

Q: Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the…

A: Genetic code is in triplets and the codes are read by the anticodon and thus the amino acids are…

Q: A. The insertion shifts the reading frame to the right. The deletion frame shifts the reading frame…

A: DNA is two stranded helical structure which act as template for making of mRNA. It also functions as…

Q: * Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG…

A: Anticodons are nucleotide sequences that are the opposite of codons. They're located in tRNAs, and…

Q: If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base…

A: The DNA sequence GCATAG will have the mRNA code CGUAUC. When the sequence changed to GCATGG, then…

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: Introduction : The genetic code is the set of rules by which information encoded within genetic…

Q: Using the codon charts in your text (section 6.1), fill in the chart below. [  /8]   Original DNA…

A: The gene expression in the cells is brought about by the various processes of Replication…

Q: Why are 3 nucleotides needed for a codon?     Because one nucleotide is redundant     Because…

A: There are five nitrogen bases - adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U).…

Q: Codons The genetic code consists of triplets of nucleotides called codons. Refer to the genetic…

A: Cells are the building blocks of life. They are the constituent structural and functional units of…

Q: Which of these single strand RNA sequences could form a hairpin secondary structure?     5'…

A: The RNA is usually a single stranded molecule of nucleic acid. In RNA four types of nitrogenous…

Q: Use your codon chart to determine the amino acid sequence.  Remember to read through the strand and…

A: Transcription is the process of copying information present in the DNA to RNA. The information…

Q: Using the example above, transcribe the following DNA strand into mRNA and translate that strand…

A: During transcription, the enzyme RNA polymerase uses DNA as a template to produce a pre-mRNA…

Q: What is the complementary DNA sequence to the following DNA sequence?   ATGCCATCG…

A: DNA is genetic material which is involved in transfer of information into the protein. It involves…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: DNA is made out of four unique sorts of nucleotides, in particular, adenine, thymine, cytosine, and…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…