Evaluate the mutation below. Original DNA strand: 3'-TACTTACGCACGGCCACT-5' Amino acids produced: methionine, asparagine, alanine, cysteine, and arginine New DNA strand: 3'-TACTTACGACGGCCACT-5' MRNA: Amino Acids: Type of Mutation:

Evaluate the mutation below. Original DNA strand: 3'-TACTTACGCACGGCCACT-5' Amino acids produced: methionine, asparagine, alanine, cysteine, and arginine New DNA strand: 3'-TACTTACGACGGCCACT-5' MRNA: Amino Acids: Type of Mutation:

Name: What is the mRNA, amino acid, and type of mutation Evaluate the mutati
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What is the mRNA, amino acid, and type of mutation Evaluate the mutation below.Original DNA strand: 3'-TACTTACGCACGGCCACT-5'Amino acids produced: methionine, asparagine, alanine, cysteine, and arginineNew DNA strand: 3'-TACTTACGACGGCCACT-5'MRNA:Amino

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 15CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’

See similar textbooks

Similar questions

1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5
1. (a) Which of the following statements is TRUE? DNA polymerase moves in a 5 to 3 direction in proofreading and correcting synthesized DNA. RNA polymerase moves in a 5 to 3 direction in synthesizing mRNA. Ribosome moves in a 3 to 5 direction during translation. tRNA moves in a 3 to 5 direction during translation. (b) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." missense mutation nonsense mutation silent mutation frameshift mutation
1. (a) What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 3 - AUUGCGGAUGCCCGUAUACG -5 5 - AUUGCGGAUGCCCGUAUACG -3 5 - AUUGCGGAUGCCCGUAUACG -3 3 - UAACGCCUACGGGCAUAUGC -5 (b) What will be the anticodons that will arrive in the translation of mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 "AAU, AUG, CGG, AUG, CCC, GAA" "UAC, GCC, UAC, GGG, CAA" "AUG, CGG, AUG, CCC, GAA" "UUA, UAC, GCC, UAC, GGG, CAA"
several options can be correct Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please select all the peptide sequence(s) that could be produced from the mRNA transcribed from this segment of DNA. (Hint: you need to use the genetic codon table to translate the determined mRNA sequence into peptide. Please be reminded that there are more than one reading frames.) Question 6 options: ...-Asp-Cys-Gln-Ser-... ...-Leu-Thr-Val-... ...-Thr-Val-Ser-... ...-Leu-Ser-Val-... ...-Met-Asp-Cys-Gln-...
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
Given Sequence: 3’-TACGGTCCGGATTCGGTAGCTAGCATC-5’ Provide: Complementary Strand: Transcript Amino Acid Sequence 2.Given Sequence: 5’-GGGCATATGCCGTTTACCGGTTTGACTAAATAACCA-3’ Provide: Complementary Strand: Transcript Amino Acid Sequence 3.Given Sequence: 3’-AAC CAA TAC GTG AGG ATA CCA AGT AAC ACT CCC-5’ Provide: Complementary Strand: Direct Transcript: Transcript for Translation: Amino Acid Sequence:
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
Is each of the following mutations a silent, missense, nonsense, orframeshift mutation? The original DNA strand is 5′–ATGGGACTAGATACC–3′. (Note: Only the coding strand is shown; the firstcodon is methionine.)A. 5′–ATGGGTCTAGATACC–3′B. 5′–ATGCGACTAGATACC–3′C. 5′–ATGGGACTAGTTACC–3′D. 5′–ATGGGACTAAGATACC–3′
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
Choose from : insertion with frameshit, deletion with frameshift, silent mutation, deletion without frameshift, missense mutation, insertion without frameshift, nonsense mutation The wildtype sequence of a gene is the following: wt: 3' TAC AAA TCT AGC CCG 5' and the following 3 mutations were found:, indicate what type of mutation this is 1: 3' TAC AAA TCA AGC CCG 5' ; 2. 3' TAC AAA TCT ATC CCG 5'. ; 3. 3' TAC AAA AGC CCG 5'. ;
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'
Use the sequences below to determine what type of mutation has occurred by comparing the normal sequence to the mutated sequence. Normal Gene Sequence: 3'- ATAGCTAAGCCCATGCGG-5' Mutated Gene Sequence 3'-ATAGCTAAGCCCAGGTGCGG-5'