How many moles of ATP and GTP will be in use for this polypeptide chain synthesis? What post-translational modifications may be for this protein? Task 2 It is known that ribozymes may be participators of translation pathway. Prove this fact.
Q: Which of the following statements regarding catabolism and anabolism is incorrect? a) All metabolic…
A: The totality of all biochemical processes that occur within a living thing is called metabolism. The…
Q: What is the dominant force behind the interaction between side chains of 2 Cys? A H-bond B…
A: Cysteine is a sulphur containing amino acid. It has side chain with thiol group (-SH).
Q: Substance that transports fatty acid from the interrnembrone space to the mitochondrial matrix? A.…
A: Long chain fatty acids must be transported into the mitochondrial matrix for beta oxidation. As they…
Q: Fill in the blanks: is the active component in Benedict's Reagent is the storage from of…
A: Various chemical reagents are used to detect the presence of certain biomolecules like…
Q: explain in detail the electron transport chain in cellular respiration
A: Cellular respiration is the process by which biological fuels such as carbohydrates, proteins and…
Q: Calculate the pH of a blood plasma sample with a total CO₂ concentration of 25.7 mM and bicarbonate…
A: The acid dissociation reaction taking place here is given below, where carbonic acid (H2CO3) gives…
Q: Sucrose is a disaccharide composed of rich of the following monosaccharides? Group of answer…
A: Carbohydrates are classified as monosaccharides, oligosaccharides, and polysaccharides based on the…
Q: Draw the peptide SMILE @ pH = 5. What is the net charge? What is the PI?
A: A peptide is a sequence of amino acids that are joined together through peptide bonds. The…
Q: DNA Protein Wild-type Gene GCCGAA Ala Ala-CH₂ Glu Ser GM AGC What is the subject of the figure…
A: Gene is the functional basic unit of heredity, composed of DNA. There are various functions genes as…
Q: how important is biochemistry during this time of CoVid 19 pandemic? explain it further.
A: CoVid 19 pandemic is due to an outbreak of viral infection that is caused by SARS CoV 19, a variant…
Q: Explain why based on the FRET data.
A: FRET (Fluorescence Resonance Energy Transfer) is a technique to tell whether proteins are…
Q: Give at least 5 sources of protein.
A: Protein is a biomacromolecule formed by repeating units of amino acids. They are the building blocks…
Q: Vancomycin is a very potent antibiotic use for several diseases such as infective endocarditis,…
A: Vancomycin is a unique glycopeptide that is structurally unrelated to most common antibiotics. This…
Q: Which of the following statements is/are FALSE about glycolysis? A. It is an anaerobic process.…
A: Glycolysis is the catabolic pathway and is the first step in cellular respiration. This metabolic…
Q: The phosphate groups in the sugar-phosphate backbone of each strand of a DNA molecule have a pKa of…
A: A DNA molecule is a strand of polynucleotides, where each nucleotide consists of a phosphate group,…
Q: describe how 18O from water can end up in C18O2. Feel free to draw structures and reference any…
A: We know that the end product of glycolysis is pyruvate which to enter citrate cycle cycle for…
Q: A.We have seen from history the role science has played in the prevention and control of diseases.…
A: Epidemiology : It is the study of diseases in a population, studying the reason , how it spread, why…
Q: Draw the Catabolism of triacylglycerols- beta-oxidation pathway, then identify and label the…
A: Fatty acids are transported into the cell. The enzyme fatty acyl-CoA synthase(FACS) adds a CoA group…
Q: a. The importance of recombinant DNA technology in Environment b. Potential products…
A: DNA : Deoxyribo nucleic acid. It is a polymer which is composed of two polynucleotide chains that…
Q: Which of the following structures represents a B-monosaccharide? О HO Т. О но. O HO HO он I -I Т. H…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: : how does Aβ affects our body?
A:
Q: QUESTIONS: 1. What is a reducing sugar? 2. Explain why sucrose is not a reducing sugar. 3. How can…
A: All the three questions are related to carbohydrates. They are answered in the next steps.
Q: What are the relative percentage (%) of species (B) and (C) at pH 7.2? (Note: treat pka's as…
A: Amino acids contain an alpha-amino group, an alpha-carboxylic group, and a side chain. The side…
Q: Differentiate the four qualitative tests for proteins BIURET, XANTHOPROTEIC, NINHYDRIN, & MILLON’S
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: a) Write out the primary sequence of the peptide b) How many peptide bonds are present in this…
A: Amino acids are biomolecules in which an amino group and a carboxyl group are linked to the same…
Q: What interactions stabilize the formation of a ß-sheet from ß-strands? a) Salt bridges from charged…
A: A protein's function depends on its structure. There are four levels of protein structure: primary,…
Q: need help to 1）hand draw the dipeptides that contains Glutamic acid and Proline. 2）hand draw the…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group attached to…
Q: A mixture of the following amino acids (glu, leu, val, arg, ser, phe) was obtained upon complete…
A: The following amino acids (glu, leu, val, arg, ser, phe) were obtained from complete hydrolysis of a…
Q: ΔG° indicates the change in the standard free energy as a reactant is converted to product. Given…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium, the concentration of reactants and…
Q: H₂N-CH-C-OH H₂N-CH-C-0 H₂N-CH-C-OH H₂N-CH-C-0- H H A OB At pH=pKa2, what is (are) the expected…
A: The proteins are composed of twenty naturally occurring amino acids. The net charge of an amino acid…
Q: Detergents disrupt hydrophobic interactions by coating hydrophobic molecules with molecules that…
A: Hemoglobin is an oligomeric protein with four polypeptides. The individual polypeptides are joined…
Q: The retention factor, Rf is measured: Any place in a spot - some of the molecules migrated there. At…
A: Rf means retention factor in a thin layer of paper chromatography. A solute or mixed sample is…
Q: Which of the following reactions in glycolysis is/are reversible? A. PEP → pyruvate B. DHAP → G3P…
A: Glycolysis is process of breakdown of one glucose glucose into two molecules of pyruvate with net…
Q: The following data describe the catalysis of cleavage of peptide bonds in small peptides by a…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 384 Answer all the questions below please! Required: At least 3-4 sentences for each answer Write…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: How many moles of ATP is produced from the “processing” of one mole of acetyl CoA through the common…
A: Citric acid cycle is known as the central hub of metabolism. This is because, the cycle connects…
Q: Galactosemia is due to? A. lactase deficiency B. accumulation of lactic acid C. accumulation…
A: Galactosemia is a metabolic disorder, due to the deficiency of the enzyme galactose-1-phosphate…
Q: The substitution of a Glutamate residue for Valine residue is a conservative substitution. True…
A: Glutamate and Valine are amino acids. Amino acids are biomolecules that have an amino group, a…
Q: Using drawn graphs or image, xan you explain the factors like pH, temperature, substrate…
A: Enzymes - Enzymes are giant protein molecules that act as biological catalysts. Like other chemical…
Q: n why a sugar can form at least two different glycosides.
A: Sugars an form two different glycosides.
Q: Which of the following is/are (a) ketose? A. tagatose B. lyxose C. erythrulose D. allose
A: Sugars or carbohydrates are the most abundant biopolymers in living organisms. Carbohydrates are…
Q: Explain why these two DNA samples give different results, when they're both 50% G-C. Fraction of DNA…
A: We know that E. coli is a prokaryote and Potoroo is an eukaryotic animal. The stability of DNA is…
Q: c) A lysine residue in the active site of UstD is involved in forming a covalent Schiff base linkage…
A: UstD is an enzyme that decarboxylates specific acidic amino acids and allows the transfer of the…
Q: write a short note on 6-mercaptopurin (purin based antimetabolite )its mechanism of action with the…
A: Purine is a heterocyclic aromatic organic compound. Purine is formed by the fusion of two rings.…
Q: Membrane proteins with specialized functions and distinct from other membrane proteins may be…
A: There are various types of proteins found throughout the cell membrane. Many of them are present…
Q: QUESTION 4 What was the distance (in cm) traveled by the SAMPLE B in the TLC below: solvent front…
A: TLC is a separation technique in which solutes or molecules are separated on the basis of their…
Q: 1. By mistake, a student placed microdrops of solutions of alanine and leucine on the same point on…
A: All the 20 standard amino acids except proline have a primary amine group . Ninhydrin is a very…
Q: Which proteins help other polypeptides to fold into the right shape?
A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…
Q: 1. Consider the enzyme pyruvate carboxylase. a. What pathway(s) does this enzyme function in? b.…
A: “Since you have posted a question with multiple sub-parts, we will solve the first four sub-parts…
Q: Which of the following is the correct sequence in the ETC? A. NADH → CoQ → cytochrome c → Fe-S →…
A: During cellular respiration, respiratory substrates like glucose may undergo complete or…
Variant 1
Task 1
One single polypeptide chain (120 amino acid residues) is produced for protein A in prokaryotic cell. N-terminal amino acid is alanine in the chain of this protein. How many moles of ATP and GTP will be in use for this polypeptide chain synthesis? What post-translational modifications may be for this protein?
Task 2
It is known that ribozymes may be participators of translation pathway. Prove this fact.
Step by step
Solved in 3 steps
- 20. in differential translation, a different transcript may be recovered depending on which TATA box is used true or falseComparing the Mechanisms of Action of EF-Tu/EF-Ts and DnaK/ GrpE (Integrates with Chapter 30.) In what ways are the mechanisms of action of EF-Tu/EF-Ts and Dna K/GrpE similar? What mechanist ic functions do the ribosome A-site and DnaJ have in common?15. Cellular proteins are oftentimes post-translationally modified. Choose one of the following PTMs: N-linked glycosylation, phosphorylation, ubiquitination, or GPI-anchor. Clearly indicate your choice, then address the following: (a) How is the PTM attached to the protein of interest? At which amino acid residue(s)? What enzyme(s) is involved, if any? (b) Is the PTM relatively stable or highly dynamic? Explain. How does the PTM become detached from the protein of interest? What enzyme(s) is involved, if any? (c) What is the function of the PTM? Provide one specific example.
- 14. Which mutation would be more harmful to a cell? For each predict the outcome of each mutation and explain one is worse than the other A) A mutation in the anticodon of Ala-tRNA from IGC to IGG OR a mutation in the alanyl tRNA synthase such that it adds either Ala or Ile to the appropriate tRNA? B) A mutation in bases 11 and 24 of the Ser-tRNA (both important recognition elements for serinyl tRNA synthase OR a mutation in the proofreading site of serinyl tRNA that inactivates proofreadingMet-enkephalin (Tyr–Gly–Gly–Phe–Met) is a painkiller and sedative (Section 21.5). What is a possible nucleotide sequence in the template strand of the gene that codes for met-enkephalin, assuming that every base of the gene is transcribed and then translated?88Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TFIIH completes ___________________ formation. A.pre-initiation complexb.TF recognition elementc.pre-elongation complexD.TATA binding complex 89Which of the following is the GDP-GTP exchange protein?A.EF-Tub.none of the abovec.EF-TsD.EF-G 90RNA polymerase II has 14 subunits. Yesorno
- 36.Start with two exons and an intervening intron. Include the cap and poly-A tail in your starting pre-mRNA. Show 2’-OH, 3’-OH, O-P-O phosphodiester bonds for the two transesterification reactions that splice exon 1 and exon 2. Be sure to include the branchpoint A and intron consensus sequences. You will need to show where the incoming -OH attacks the O-P-O bond to allow correct splicing in the lariat and between exons. Make your arrows precise. Show the lariat with the consensus sequences. Whenever possible, show 5’ and 3’ ends. Explain the fate of the lariat after it forms?46What is the A-site of the ribosome? A.exit siteb.aminoacyl-tRNA binding sitec.peptidyl-tRNA binding siteD.peptidyltransferase site 47This sequence motif, which is called the ( ) , is usually located 25 to 30 bp upstream from the transcription initiation site. 48Pre-mRNA requires specific sequences for precise __________ to occur. A.splicingb.taggingc.replicationD.skippingOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
- Question:- Fill the Blank! In bacteria, the ___consensus sequence of mRNA binds to the ____rRNA of the 30S small subunit during translation initiation, while in eukaryotes, the _______ consensus sequence of mRNA contains the_____.5’-AUGCCGGACUGAAAU-3’ What is the sequence of the resulting protein assuming the ribosome takes the first AUG as triplet codon ?44. Mature human insulin is synthesized from a single Gene but contains two polypeptide chains (A and B) linked by disulfide bonds. Which of the following statements about the A and B chains provides the best explanation for the production of human insulin?a. They are identical and combine to form the mature insulin - A has 21 chains, Bhas 30b. They are produced by proteolytic processing of a single translation productC. They are the products of alternative translation-initiation sites on a single mRNAd. They are the product of a separate A- and B-chain mRNA produced byalternative splicing - would lead to protein diversitye. They are the products of separate A- and B-chain mRNA synthesized fromalternative promoters