1. (a)What mutation would result to a change of AUG codon to AGG? missense mutation nonsense mutation silent mutation frameshift mutation (b) Which mutation that would result to a change of amino acid in the polypeptide? missense mutation nonsense mutation silent mutation frameshift mutation
Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in…
A: DNA ( deoxyribonucleic acid ) is the hereditary material in humans and almost all other organisms.…
Q: A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine…
A: In this question, we are given with a portion of mRNA which has a sequence 5' GACAUGAACAGC 3'. mRNA…
Q: An mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the…
A: Missense Mutation: A missense mutation is a point mutation that results in a codon that codes for a…
Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…
A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…
Q: What type of mutation occurred at mutation #2 and does it cause a frameshift? Sequence Original…
A: Mutation is a change in nucleotide sequence of DNA. There are various types of mutations. Point…
Q: 7. How many different mRNAs could specify the amino acid sequence met-phe-ser-pro? 8. Agene contains…
A: Ans 7: Genetic codes are triplet in nature. Genetic codons are degenerate in nature, which means,…
Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…
A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…
Q: 1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: Match up the DNA mutation with its description: Silent a. a point mutation where one amino acid is…
A: Silent - g) a point mutation where the amino acid sequence are unchanged Missense mutation - a) a…
Q: All of the following occur when the amino acids of two tRNA molecules are joined, except. a. The…
A: DNA replication, transcription, and translation are the molecular processes that are responsible for…
Q: Codon in Codon in Amino Acid DNA template strand MRNA APP gene in individuals 3'-CAA-5' 5'-GUU-3'…
A: Alzheimer's disease causes the brain's atrophy to shrink and the cells of the brain to die. Dementia…
Q: 1. Here is the amino acid sequence of part of a hypothetical gene you want to clone:…
A: The degeneracy of the genetic code explains that most of the amino acids defined by more than one…
Q: 1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the…
A: DNA replication is the process in whichbbhvgvhghhccvfgcbgvh
Q: 26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C-…
A: Since we only answer one question at a time, we’ll answer question 27 (as you have already solved…
Q: 1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of…
A: Introduction: The changes or alteration in the sequence of DNA is known as mutation.
Q: 1. Why Phosphate bond is important in DNA or RNA structure? 2. Why G-C forms three hydrogen bonds…
A: Molecular biology is the branch of science that studies various biological molecules like nucleic…
Q: Mutated DNA Sequence #1: T A C A C C T T G G G A C G A C T What will be the…
A: Deoxyribonucleic acid (DNA) contains four nitrogenous bases. These are Adenine (G), Guanine (G),…
Q: . (a) Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 AAU…
A: Ans - a.) AUG is the start codon in the mRNA 5 - AAUAUGCGGAUGCCCGAA -3. # AUG acts as initiator…
Q: 1. Given the anticodon in tRNA is CUU, name the amino acid that will be added. 2. Given the…
A: Since it is a multipart question we are supposed to answer only the first three questions as per the…
Q: 28. What type of mutation is seen here? WT: 5′-AUG GCU AGA GUU GAA AAA-3′…
A:
Q: A point mutation within a codon that does not change the resulting amino acid sequence is known as…
A: Mutation is a change of nucleotide sequence of DNA. When there is a change in single nucleotide of…
Q: 21. Which of the following mutations would be expected to have the most harmful effect on the…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 7. The following amino acid sequence represents part of a protein. The normal sequence and a mutant…
A: A mutation is a change in the nucleotide sequence of an organism's genome, virus, or…
Q: mutation 5' 1 3' 5' 3' 5' 3' 4 Mutations in splice sites can lead to the formation of abnormal…
A: Several genetic diseases could also be the results of splice website mutations. as an example,…
Q: A codon is supposed to be 5'-UGG-3', but a mutation causes it be 5'-UAG-3'. Which one of the…
A: Mutations are sudden changes in the genetic material. Mutations are heritable. Mutations are random.…
Q: a) The genetic code in unambigous that means many codons can code for the same amino acids. b)…
A: 1. The genetic code is UNAMBIGUOUS:- Means that each triplet specifies only a single amino acid.…
Q: 25. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a…
A: The translation is a process of Protein synthesis where a copy of mRNA is used as a template strand.…
Q: Frameshift mutation _____________________ Select one: can result in a completely new codon sequence…
A: These mutations include insertions or deletions in between the nucleotide sequence of the genome,…
Q: Original DNA Sequence: T A C G C A A A A A T C G A T C G A A C T mRNA Sequence: Amino Acid Sequence:…
A: There are various types of mutation that takes place in the DNA sequence among which the three basic…
Q: 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Could a frameshift mutation result in the production of a larger than wild type protein?
A: Frameshift mutation occurs due to deletion or addition if nucleotides which produces non functional…
Q: 17) Codons are three-base sequences in mRNA that specify the addition of a single amino acid to the…
A: 17) Correct answer is option d(codon are a nearly universal language among all organisms) because…
Q: What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?
A: A mutation in the gene that changes its anticodon loop for a tRNA molecule can "suppress" nonsense…
Q: Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a…
A: The DNA is transcribed into to an RNA by the process of transcription. Following the transcription…
Q: Frameshift Insertion Mutation – Can be one or more nucleotides. 5’ ATG GGG AAA GAT TAT…
A: Any heritable change in an individual's genetic makeup is referred to as a mutation. It's when a…
Q: 3). Explain a substitution mutation 4) Explain a deletion mutation 5). Explain an insertion…
A: 3. Substitution mutation: change of a single base causes change of the amino acid.
Q: After exposure to gamma radiation, the following mutation occurs in the template strand: 5’ GTA GGG…
A: Radiation cause mutation in the DNA this varies from point mutation to chromosomal aberrations. The…
Q: 1. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 -…
A: The protein is synthesized by the translation process. It takes place in the cytoplasm.
Q: 1. (a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…
A: 1.(a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…
Q: Match the term with its corresponding definition. a. Insertion e. Nonsense Mutation b.…
A: Mutation is a process wherein a DNA gene is damaged or changed in such a way that the genetic…
Q: 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand:…
A: Transcription is the process of synthesis of mRNA by using a template DNA strand. Translation is the…
Q: 22. Which of the following mutations would be expected to have the most harmful effect on the…
A: Mutations Mutations are defined as any change or alteration in the base sequences of the DNA further…
Q: 2. A reversion is a mutation that returns a mutant codon back to a codon that gives a wild-type…
A: Reversion mutation is one that causes such a change in the gene that does not cause change in…
Q: 4. How many codons are in the longest ORF? 5. What is the frame of the shortest ORF? 6. How many AA…
A: ORF is a stretch of DNA sequence that begins with translation initiation site (start codon) and ends…
Q: 6. Given: 3--TACTTCAAACCGGGCCCGATT--5 a) Give the sequence of nucleotides in the mRNA. b) What is…
A: The DNA is translated into mRNA by transcription process and then the mRNA is translated into…
Q: 5’ UGG CAA UCC UAC GAU 3’ Write out the sequence of the anticodon in the tRNA that would bind to…
A: Note: As per the guidelines only one question has to be answered. Please ask the other question…
Q: double-stranded RNA
A: ribonuclease III family Enzymes from the ribonuclease III family bind and cleave…
Q: If a DNA triplet is CGA A. What is the mRNA codon? B. What is the tRNA anticondon? C. What amino…
A: According to guidelines we have to answer the first question only. so please kindly post the…
|
missense mutation
|
||
|
nonsense mutation
|
||
|
silent mutation
|
||
|
frameshift mutation
|
(b) Which mutation that would result to a change of amino acid in the polypeptide?
|
missense mutation
|
||
|
nonsense mutation
|
||
|
silent mutation
|
||
|
frameshift mutation
|
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 1. (a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." missense mutation nonsense mutation silent mutation frameshift mutation (b) How many codons are found in the mRNA below?mRNA 5 - AAUAUGCGGAUGCCCGAA -3 4 5 6 71. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 4 5 6 7 (b) "In this mutation, the UGG codon is replaced with UGA." missense mutation nonsense mutation silent mutation frameshift mutation1. (a) Which of the following statements is TRUE? DNA polymerase moves in a 5 to 3 direction in proofreading and correcting synthesized DNA. RNA polymerase moves in a 5 to 3 direction in synthesizing mRNA. Ribosome moves in a 3 to 5 direction during translation. tRNA moves in a 3 to 5 direction during translation. (b) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." missense mutation nonsense mutation silent mutation frameshift mutation
- 3). Explain a substitution mutation 4) Explain a deletion mutation 5). Explain an insertion mutationAs bacterial DNA replicates, a point mutation occurs in which an A nucleotide is changed to a C nucleotide. Although the mutation changes the codon sequence, it does not change the resulting amino acid in the protein. This would best be described as a missense mutation. splicing site mutation. frameshift mutation. nonsense mutation. silent mutation.A mutation has occurred to a wild type mRNA sequence: Wild Type: 5’-AUG-UUG-CAA-GCG-3’ The new mutated sequence: 5’-AUG-UUG-UAA-GCG-3’ What kind of mutation has occurred? a)Silent mutation b)Missense mutation c)Nonsense mutation d)Frameshift mutation
- Part 1: Matching Match the term with its corresponding definition. a. Insertion e. Nonsense Mutation b. Deletion f. Missense Mutation c. Frameshift Mutation g. Germ-line Cells d. Silent Mutation h. Somatic Cells ____ 1. Remove a base or bases ____ 2. Add a base or bases ____ 3. Mutations in these cells are not passed to future generations but are passed to other body cells derived from them ____ 4. Mutation in which an amino acid is changed to a stop codon and the protein is truncated ____ 5. Mutations in these cells are passed to future generations ____ 6. Results if an insertion or deletion throws the reading frame of the gene message out of register ____ 7. Mutation where the protein does not change ____ 8. Mutation where a codon is changed resulting in another amino acid inserted in…1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…1. (a) Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 AAU UUA AUG UAG (b) There is an addition of Adenine in the mRNA sequence specifically at AUG codon. missense mutation nonsense mutation silent mutation frameshift mutation
- Mutated DNA Sequence #1: T A C A C C T T G G G A C G A C T What will be the corresponding mRNA sequence? What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…For each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.