Q: Construct pedigree charts using the inheritance of hemophilia in figure 92 (page 113). This is X-lin...
A: Pedigree chart is a family tree helps to understand the inheritance of a particular trait or disease...
Q: Explain the anatomical concepts associated with the urinary system. Summarize this module’s key poin...
A: The nervous system is made up of neurons, which are specialised cells that can receive and transmit ...
Q: What are terpenes? 2. Essential function of terpenes in plants? 3. What is the difference between te...
A: The secondary metabolites in plants helps in defence and communication. The secondary metabolites ar...
Q: How does a rib articulate with a thoracic vertebra?
A: The skeletal system is usually defined to stated that they are been made up of all the bones and joi...
Q: What are the roles of ATP and NADPH in photosynthesis?
A: Photosynthesis is a process that plants and other living things use to convert light energy into che...
Q: Which of the following adaptations exploits the viscosity property of water? (Check all that apply) ...
A: Viscosity is a fluid's thickness that causes objects to face resistance when moving through it. The ...
Q: is there a correlation between one medium supporting growth at a wide set range or organismal growth...
A: A growth medium is designed to grow different types of cells. It is also known as culture medium and...
Q: Nde I EcoR I Sal I KpnI BamH I PUST MCS ori Xho I Amp BamH I Kpn I EcoR I BamH gene W pn BamH I Xho ...
A: Gene insertion is that the addition of one or a lot of genes into a desoxyribonucleic acid sequence,...
Q: Sensate focus is the most common treatment for premature ejaculation. T or F?
A: Ejaculation can be defined as the process of releasing a sexual gamete that is sperm cells male repr...
Q: ompany to reduce the pollution
A: Fossil fuels are coal, petroleum, natural gas, oil shales, bitumens, tar sands, and heavy oils. th...
Q: Why does evenly distributed peak in DNA chromatogram is an indication of a good sequence?
A: Evenly spaced peaks indeed indicate a good DNA sequence. Generally, four colours of peaks are obta...
Q: 5. One student has got 300 g of carbohydrates and 50 g of proteins with dinner, another- 300 g of ca...
A: In general, most adults should target their diets to comprise of 45-65% Carbohydrates, 10-35% Protei...
Q: Explain in 2-3 sentence about the advantage and disadvantage of using plastic in your everyday life.
A: Plastics are the synthetic polymers of carbon and other elements with high molecular weight . It is ...
Q: The cornsnake (Pantherophis guttatus) has a recessive allele for pigmentation that causes albinism (...
A: Reptiles are the class of Animals that are cold blooded. They inhabit both, the land and the waters....
Q: Nde I EcoR I Sal I Kpn I BamH I PUST MCS ori Xho 1- Ampe BamH I Kpn I EcoR I BamH I gene W Xhe
A: Introduction A chemical reaction is a process in which the reactants are converted into a product w...
Q: Which of the following are not used for mechanical digestion? A. Pancreatic juice B. Saliva C. Bile ...
A: F- none of the above. Mechanical digestion involve mastication however chemical digestion involved ...
Q: If you saw a red afterimage of flag stripes after staring a green-striped flag for a long-time, it i...
A: The term vision is associated with the living beings’ ability to detect the difference between diffe...
Q: 5. Which positioning would you choose for Flumist? Why?
A: FluMist is a flu vaccine in the form of a nasal spray and is administered through the nose to provid...
Q: Isovolumetric contraction" is a phase in the cardiac cycle in which the volume of a particular heart...
A: Isovolumetric contraction" is a phase in the cardiac cycle in which the volume of a particular heart...
Q: What do these results suggest about the role of PKA in insects that are always gregarious? O Insects...
A: ANSWER;- a) Insects that are always gregarious show an aberrant PKA activation cycle Explain;- PKA i...
Q: What is the main difference in chemical input between aerobic and anaerobic cellular metabolism?
A: The process of breaking down sugar in the mitochondria of organisms in the presence of oxygen to rel...
Q: What is genetic disorders? Explain by giving an example.
A: Genetics is described as the branch of biology that focuses on the study of genes, their inheritance...
Q: Explain the concepts of TDT (Thermal Death Time) and TDP (Therma Death Point), and discuss one examp...
A: The thermal death point (TDP) of a microorganism is the lowest temperature at which all microbes are...
Q: Imagine you will use a centrifuge in the laboratory indicating rpm and your protocol requires 3500xg...
A: Centrifuge Device: A centrifuge is a laboratory apparatus that separates fluids, gaseous or liquid...
Q: Describe and identify on which segment of the legs/limbs would you expect the ambulatorial, fossoria...
A: Fossorial legs: * These legs are also called as digging legs. *Forelimbs of insect contains Fossori...
Q: 1)What is a test-cross? 2)Why might a geneticist need to do a test-cross and how are the results us...
A:
Q: Briefly outline the pathway by which the immune system becomes aware of and responds to Streptococcu...
A: Innate immunity is well known term that is usually defined as the first non-specific immunological t...
Q: 1.The Philippines is a developing country and many of its areas are classified as geographically- is...
A: There are few points about parasite : we know that parasites are living on other body for food and ...
Q: Norm Scully has led a life of gluttonous excess for the past 40 years. Because of this, he wants to ...
A: Let us look into the meaning of each type of research - 1. Technical analysis - In this context, te...
Q: If stroke volume is 0.1 liters and heart rate is 100 beats per min, what is cardiac output? Group of...
A: Cardiac output (CO) is the measure of how much blood your heart pumps each minute. It is calculated ...
Q: Number of cycles 1 сycle Step Temperature Time Initial Denaturation 98°C 5 minutes Denaturation (a) ...
A: Polymerase Chain Reaction requires 5 most important aspects before starting with the protocol, these...
Q: Describe a nucleic acid.
A: Nucleic acids carry and store information and pass this information from parent cells to daughter ce...
Q: Complete th information and identify Role 1. The hor stimulates of ovarian 2. The hor: secreted by l...
A: Hormones : These are the chemicals which are released in body These chemicals acts as a messenger w...
Q: Please help me answer this reviewer. Write the word TRUE if the statement is correct and if not, un...
A: 1. Gynogenesis is the process of animal development with exclusive paternal inheritance. Answer: Gyn...
Q: When light hits the center of an ON-center receptive field, which of the following processes occur: ...
A: The following facts are required to be known to answer this question with logic:- Suppose there is ...
Q: Why are fruit flies considered a model genetic organism? Would humans fit this description?
A: Introduction:- The study of how genes and traits are passed down from one generation to the next is ...
Q: Placentals Marsupials Monotremes Mammals AMNIOTA Birds Crocodiles Lizards + Snakes TETRAPODA Tuatara...
A: Agnathans are different class from Gnathostomata. So it is placed as a different node in the table w...
Q: At the hydrothermal vent in the deep sea, the specific symbiotic relationship between the bacteria t...
A: A close ecological link between organisms of two or more species is known as symbiosis. Sometimes bo...
Q: What is the protective function of mucus?
A:
Q: Determine what the statement is describing. Fill in the blanks with the correct/best answer. 1. Gen...
A: Genetic engineering is the act of altering genetic material by interfering with genetic processes in...
Q: Why would one use the Goldman-Hodgkin-Katz equation? • What is the role of the Na+/K+ pump in establ...
A: Introduction :- In cells, the Na+K+-ATPase pump aids in maintaining osmotic balance and membrane pot...
Q: Pancreatic juices, saliva, and bile are used only for mechanical digestion? A. True B. False
A: Mechanical digestion comprises physically breaking down food items into smaller chunks in order for ...
Q: Cleavage blastomeres are totipotent. Differentiate th
A: Totipotent : A totipotent cell is a single cell that can give rise to a new organism , given materna...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: Consider that leaves are added to a soil. The compound in the leaves that is most resistant to bacte...
A: Decomposition is process of decaying of materials.
Q: occurring
A: The Department of agriculture regulates field testing of GM crops for research. The environmental pr...
Q: Suppose a person with the dominate blood form and a person with the other dominate blood form type g...
A:
Q: Suppose a person with the co-dominate blood form and a person with recessive blood form type get mar...
A: Introduction: Codominance is a heterozygous condition in which both alleles at a gene locus are ful...
Q: distinguish between bacterial cells that obtained the plasmid and those that did not
A: Bacteria are single celled organisms with a unique internal structure.
Q: 1. I. What molecule holds instructions tor the synthesis of proteins and copies itselt tor the next ...
A: Introduction :- Proteins are macromolecules that are polymers of structural units known as amino aci...
Name the synthetic growth substances from plant hormones abscisic acid and ethylene and discuss their commercial applications
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- List five main groups of natural plant growth regulators. Write a note ondiscovery, physiological functions and agricultural/horticultural applicationsof any one of them.Differentiate between plant growth regulators and plant growth inhibitors.Explain the differences between plant hormones and plant growth regulators
- Give an example of an environmental condition where stomates are unable to maintaincooling of the leaf and heat stress occurs. Explain the consequences of heat stress onphotosynthesis, membrane integrity and proteins.Application of synthetic compounds could artificially modify the plant growth and development, i.e. inducing germination in dormant seeds, producing parthenocarpic fruits, promoting shoot initiation in tissue culture. Collectively, they are called ________________ which are synthetic compounds that imitate the organic naturally occurring substances that modify plant growth anddevelopment at low concentrations.Explain plant growth regulators and their role in plant growth and its procedure of function?
- Explain what are Plant Growth RegulatorsPositive phototropism is one of the most obvious aspects of plant growth but the mechanism behind it required considerable experimentation to finally explain. Briefly describe how positive phototropism works, including the processes, structures and/or molecules involved.List 3 environmental factors discussed in lectures and give examples of physiological and biochemical perturbations in plants caused by fluctuations in these environmental factors. For each of the 3 environmental factors describe the primary effects and the secondary effects.
- What are terpenes and terpenoids? Briefly discuss their main functions and importance in plants. Discuss the significance of the following tests and what constituent is being detected: Keller-Kiliani test Froth test Liebermann-Burchard test Capillary Tubes test Kedde testJustify the use of metalaxyl to treat maize seeds and its influence on the growth and appearance of corn plants. Describe the mechanism by which metalaxyl is used to combat downy mildew.Match the following: Zinc Calcium Nitrogen Phosphorous Copper 1. Overall growth and chlorophyll structure. 2. Reproduction and root metabolism. 3. Root and flower growth. 4. Cell wall and overall strength. 5. Regulation of plant growth.
