Determine the value of K, for the following reaction if the equilibrium concentrations are as follows: [H2leg = 0.14 M, [CI 2leg = 0.39 M, [HCIJeg = 1.6 M.H2(g) + Cl 2(g)+ 2 HCI(g)3.4 x 10-22.1 x 10-2O 8.7 x 10-229O 47

Answered: Image /qna-images/answer/bf4c3d71-3c95-43d1-8611-c9083a3110eb.jpg

Answered: - of Ke for

Science

Chemistry

- of Ke for

Chemistry: The Molecular Science

5th Edition

ISBN:9781285199047

Author:John W. Moore, Conrad L. Stanitski

Publisher:John W. Moore, Conrad L. Stanitski

Chapter12: Chemical Equilibrium

Section: Chapter Questions

Problem 34QRT

See similar textbooks

Related questions

Q: Draw the reaction mechanism of adenosine monophosphate and guanosine monophosphate (with curly arrow...

Q: Identify the proper form of the equilibrium-constant expression for the equation N2 (g) + O2 (g) = 2...

Q: For the following systems at equilibrium A: 2NOCI(g) B: H2(g) +I2(g) = 2NO(g)+Cl2 (g) = 2HI(g) class...

A: According to Le Chatlier's principle, if any change is made to an equilibrium system, the system shi...

Q: 2. Propose a multistep synthesis for the following synthetic transformation: OH 3. How would you act...

Q: A sample of meat scrap weighing 2.000 g is digested with concentrated sulfuric acid and a catalyst. ...

A: The excess 0.6700 N H2SO4 requires to neutralize NaOH. The volume of 0.6700 N H2SO4 requires can ...

Q: 1. Draw the compound in expanded, condensed and skeletal form. ALL compound must be hand drawn. 2. C...

A: Atenolol is a type of drug which is used to treat blood pressure and arrhythmia.

Q: For the reaction X(g) + 2Y(g) = 3Z(g) Kp = 2.08x10-2 at a temperature of 325 °C . Calculate the valu...

A: Given reaction: X (g) + 2Y (g) ⇌ 3Z (g) Given, Kp = 2.08×10-2 at 325 ∘C We have to find the value of...

Q: Calculate the activity of La3+ in a saturated solution of La(IO3)3 in 0.010 M La(NO3)3. Ksp = 1.0 ...

Q: Rank the isomers in order of increasing heat of formation. Highest heat of formation Lowest heat of ...

Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show...

Q: 31. How many percentage of the radical cation peak of (M +1) will be observed approximately when the...

A: The relative natural abundance of M+1 that is 13C is 1.1% required the relative natural abundance of...

Q: Consider the following reaction: CH4(g) +2 H2S(g) CS2(g) + 4 H2(g) A reaction mixture initially cont...

Q: pH

Q: At a certain temperature the rate of this reaction is first order in NH,OH with a rate constant of 0...

Q: 23) Translate the structure below to a Fischer projection and assign absolute configurations to the ...

A: We will give the priopity to the group according to CIP rule. Priority is given on the basis of ato...

Q: Read and interpret the following information using the following abstract from a scientific journal ...

A: Here the Abstract of the research publication is needed to be summarized in two to three sentences. ...

Q: NH3: S= 193; H = -46.3 %3D HCl: S=187; H= -92.3

A: The reaction which are spontaneous is given below

Q: Aluminum oxide, Al203, is used as a filler for paints and varnishes as well as in the manufacture of...

Q: A protein binds a ligand with a KD value of 0.25 M. If you are at a ligand concentration of 0.63 M, ...

A: Fraction of the protein that bound at given ligand concentration is given by: ...

Q: Rank the isomers in order of increasing heat of formation. Highest heat of formation Lowest heat of ...

A: The alkenes are compound which composed of carbon and hydrogen and contains at least one double bond...

Q: Read carefully the given partial names in IUPAC alkane nomenclature and check the columns where they...

Q: Calculate the quantity of heat in kJ, associated with a 33.5oC decrease in temperature in a 5.85 kg ...

Q: How many moles are in 1.05 x 1022 molecules of an unknown compound? Your Answer: Answer units

A: Here, we have to find the number of moles present in 1.05 × 1022 molecules of an unknown compound.

Q: complete ionic equation for A. 3CaCl2(aq)+2Na3PO4

Q: conjugate base

Q: QUESTION 1 After removing the pH meter electrode from the 3.0M KCL solution, the glass electrode is ...

Q: ions

Q: How many moles of Mg are there in a sample of Mg that contains 1.36x1024 atoms? moles

A: Given Atoms of Mg = 1.36 x 1024 atoms

Q: How many moles of N are there in a sample of N that contains 2.75×1024 atoms?

Q: Explain why any or all of the following solvent pairs cannot be used for mixed-solvent recrystalliza...

A: This type of crystallization is one of the methods for obtaining high quality, pure, single crystals...

Q: Show the pentose phosphate pathway that produces PRPP and reducing equivalents such as NADPH

A: 1) Pentose phosphate pathway (PPP) is composed of two phases :- 1) Oxidative phase , where producti...

Q: Consider the following table: Name Formula Conjugate Acid 1.8 x 10 5 4.38 х 10 4 NH3 NH,+ Ammonia Me...

A: For best buffer solution pH of the solution should be equal to pKa of acid. For effective buffer so...

Q: 3. 4. 500 mL of 0.75 N of K2Cr20, from a pure solid reagent if it follows the following half reactio...

Q: t takes a runner 37 minutes to complete a 10 km course. What is his/her average speed in miles per h...

Q: Draw the correct product for the Diels-Alder reaction. Select Draw Rings More

A: Diels Alder Reaction is stereospecific in nature. Diels - Alder Reaction is a kinetically controlled...

Q: Add the following to 400ml H2O (not from the tap!) 5.4 g Tris base 50.0ml 10X Boric acid (55.0 ...

A: A question based on concentration terms that is to be accomplished.

Q: How many grams of Xe are there in a sample of Xe that contains 8.97×1023 atoms?

A: First we have to determine the moles of xenon.

Q: Balance the given molecular equation using redox (electron-transfer method). Identify the element ox...

Q: ct product fo

Q: Compute the charge of the following ions. 1.) Ion with a charge of -2 2.) Ion with a charge of +5

A: An electron is a subatomic particle with an electric charge equal to 1.602 × 10-19 coulomb in magnit...

Q: 5) Which of the following statements is a correct description of the most stable conformation of 1,1...

Q: 11:36 O ... 66 X How many grams of Au are in ../1 0.053 mol of Au? 1 X How many Ga atoms are in ./1 ...

A: We know that, Number of moles = mass/molar mass

Q: HO. The given structures are isomers. (A Positional B Functional Conformational D Skeletal

A: Isomer are define as a molecule having same molecular formula but different arrangement of atom in a...

Q: sa dipole moment?

Q: moles o

Q: Sulfanilamide, a sulfur drug, acts as an antibiotic. Explain its mechanism of action in the context ...

A: Ans. Sulfanilamide: An enzyme Inhibitor: Sulfa drugs work by binding and inhibiting a specific enzym...

Q: Predict whether the reaction will shift left, shift right, or remain unchanged upon each of the foll...

A: The correct answer is given below

Q: Some measurements of the initial rate of a certain reaction are given in the table below. H2 2| init...

Q: Under certain conditions the rate of this reaction is zero order in hydrogen iodide with a rate cons...

A: A zero order reaction is the independent of the reactant concentration. And formula used [A]t = - k...

Q: 7. Consider the crystallization of sulfanilamide from 95% ethyl alcohol. If impure sulfanilamide is ...

A: Concept:-

Concept explainers

States of Matter

The substance that constitutes everything in the universe is known as matter. Matter comprises atoms which in turn are composed of electrons, protons, and neutrons. Different atoms combine together to give rise to molecules that act as a foundation for all kinds of substances. There are five states of matter based on their energies of attraction, namely solid, liquid, gases, plasma, and BEC (Bose-Einstein condensates).

Chemical Reactions and Equations

When a chemical species is transformed into another chemical species it is said to have undergone a chemical reaction. It consists of breaking existing bonds and forming new bonds by changing the position of electrons. These reactions are best explained using a chemical equation.

Question

Determine the value of K, for the following reaction if the equilibrium concentrations are as follows: [H2leg = 0.14 M, [CI 2leg = 0.39 M, [HCIJeg = 1.6 M.
H2(g) + Cl 2(g)
+ 2 HCI(g)
3.4 x 10-2
2.1 x 10-2
O 8.7 x 10-2
29
O 47

Expert Solution

Step 1

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.

Similar questions

Suppose a reaction has the equilibrium constant K = 1.3 108. What does the magnitude of this constant tell you about the relative concentrations of products and reactants that will be present once equilibrium is reached? Is this reaction likely to be a good source of the products?
The equilibrium constant Kc, for the reaction 2 NOCI(g) 2 NO(g) + Cl2(g) is 3.9 103 at 300 C. A mixture contains the gases at the following concentrations: [NOCl] = 5.0 103 mol/L, [NO] = 2.5 103 mol/L, and [Cl2] = 2.0 103 mol/L. Is the reaction at equilibrium at 300 C? If not, in which direction does the reaction proceed to come to equilibrium?
The experiment in Exercise 12.33 was redesigned so that the reaction started with 0.15 mol each of N2 and O2 being injected into a 1.0-L container at 2500 K. The equilibrium constant at 2500 K is 3.6 X 10“’. What was the composition of the reaction mixture after equilibrium was attained? The following reaction establishes equilibrium at 2000 K: N2(g) + O2(g) *2 2 NO K = 4.1 X IO-4 If the reaction began with 0.100 mol L-1 of N2 and 0.100 mol L-’ ofO2, what were the equilibrium concentrations of all species?
Because calcium carbonate is a sink for CO32- in a lake, the student in Exercise 12.39 decides to go a step further and examine the equilibrium between carbonate ion and CaCOj. The reaction is Ca2+(aq) + COj2_(aq) ** CaCO,(s) The equilibrium constant for this reaction is 2.1 X 10*. If the initial calcium ion concentration is 0.02 AI and the carbonate concentration is 0.03 AI, what are the equilibrium concentrations of the ions? A student is simulating the carbonic acid—hydrogen carbonate equilibrium in a lake: H2COj(aq) H+(aq) + HCO}‘(aq) K = 4.4 X 10"7 She starts with 0.1000 AI carbonic acid. What are the concentrations of all species at equilibrium?
Consider the following equilibrium: COBr2(g) CO(g) + Br2(g)Kc = 0.190 at 73 C (a) A 0.50 mol sample of COBr2 is transferred to a 9.50-L flask and heated until equilibrium is attained. Calculate the equilibrium concentrations of each species. (b) The volume of the container is decreased to 4.5 L and the system allowed to return to equilibrium. Calculate the new equilibrium concentrations. (Hint: The calculation will be easier if you view this as a new problem with 0.5 mol of COBr2 transferred to a 4.5-L flask.) (c) What is the effect of decreasing the container volume from 9.50 L to 4.50 L?
At room temperature, the equilibrium constant Kc for the reaction 2 NO(g) ⇌ N2(g) + O2(g) is 1.4 × 1030. Is this reaction product-favored or reactant-favored? Explain your answer. In the atmosphere at room temperature the concentration of N2 is 0.33 mol/L, and the concentration of O2 is about 25% of that value. Calculate the equilibrium concentration of NO in the atmosphere produced by the reaction of N2 and O2. How does this affect your answer to Question 11?
At 2300 K the equilibrium constant for the formation of NO(g) is 1.7 103. N2(g) + O2(g) 2 NO(g) (a) Analysis shows that the concentrations of N2 and O2 are both 0.25 M, and that of NO is 0.0042 M under certain conditions. Is the system at equilibrium? (b) If the system is not at equilibrium, in which direction does the reaction proceed? (c) When the system is at equilibrium, what are the equilibrium concentrations?
The decomposition of PCl5(g) to form PCl3(g) and Cl2(g) has Kc = 33.3 at a high temperature. If the initial concentration of PCl5 is 0.1000 M, what are the equilibrium concentrations of the reactants and products?
What is Le Chteliers principle? Consider the reaction 2NOCI(g)2NO(g)+Cl2(g) If this reaction is at equilibrium. what happens when the following changes occur? a. NOCI(g) is added. b. NO(g) is added. c. NOCI(g) is removed. d. Cl2(g) is removed. e. The container volume is decreased. For each of these changes, what happens to the value of K for the reaction as equilibrium is reached again? Give an example of a reaction for which the addition or removal of one of the reactants or products has no effect on the equilibrium position. In general, how will the equilibrium position of a gas-phase reaction be affected if the volume of the reaction vessel changes? Are there reactions that will not have their equilibria shifted by a change in volume? Explain. Why does changing the pressure in a rigid container by adding an inert gas not shift the equilibrium position for a gas-phase reaction?