On the quantitative PCR diagram, C T shows the: a. fluorescence intensity. O b. number of copies of the original CDNA template. Oc number of copies of the original template. Od. starting quantity of DNA. e. cycle number at which fluorescence becomes detectable.

Q: The synthesis sequence sho

A:

Q: Br2 uv dentify the Match each item to a choice: Initiation Termination

A: There are main three steps in this reaction that are initiation, propagation and termination. 1)…

Q: Agarose gel electrophoresis is relatively simple and straight forward to perform. Agarose is a…

A: two monomer units present in agarose are:

Q: Humulin R U-100 insulin 30Units = ________ml

A: Interpretation-  To determine the volume of Humulin R U-100 insulin 30Units = ________ml -…

Q: The pK value for N1 of adenine is 3.64, whereas the pK value for N1 of guanine is 9.50. Explain this…

A:

Q: Which of the following is not a stage that occurs during translation? A) elongation B) mutation C)…

A: The synthesis of protein from an mRNA (messenger ribonucleic acid) by the enzyme peptidyl…

Q: 4. what would be the pathuiay to get this trans formation Q ccomplished? starting material

A: Given : Reagent and product for a reaction. To find: Mechanism for this reaction and suitable…

Q: AHO(T) = a +bT for a two-state folding ribonuclease is roughly 30°C. At T = 27°C the fraction of…

A: Given : ∆H∘T = a + bT  at 30∘C Temperature is 27oC Fraction of folded state is 0.75 To find:…

Q: In mass spectrometry, alpha cleavages are common in molecules with heteroatoms. Draw the two…

A: Two alpha cleavages in the given molecule is represented as

Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show…

A:

Q: repression of a eukaryotic gene by an RNA be more efficient than repression

A: In this question we have to choose correct option of a repression pa a eukaryotic gene by an RNA be…

Q: Why is DNA quantification so important after the isolation of DNA?

A: Biomolecules can be defined as the molecules which are involved in different biochemical reactions…

Q: NH2 HN-DNA H,N-DNA N-DNA OCH, HN. HN-DNA H,C NH H,C NH2 Mitomycin C DNA adduct Mitomycin C is an…

A: The mechanism for this goes as follows.

Q: Br2, CH3OH

A:

Q: Which reagent used in PCR reactions makes a particular PCR experiment specific? (Which reagent…

A: PCR primer

Q: A pioneer in designing and synthesizing antimetabolites that could destroy cancer cells was George…

A: Biomolecules play a very important role in our body. They exist in different forms depending upon…

Q: Draw the intended fragments without identifying the compound (just fragment practice please! super…

A: Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: 2. Explain why the restriction endonucleases BglII (A^GATCT) and Xbal (T^CTAGA) will not recognize…

A: DNA molecules are cut with the help of restriction enzymes at specific places which helps in…

Q: partition coefficient

A: Given: Some amount of compound A is dissolved in 100 mL of water. When 100 mL of DCM is added, 80%…

Q: The interconversion of cyclic anomer from alpha to beta configuration is called ______.

A: The interconversion of cyclic anomer from alpha to beta configuration is called mutarotation.…

Q: In the figure below, His carries out generates| tetrahedral intermediate is stabilized by the by…

A: In the given figure, the lone pair of electron on the nitrogen of Histidine residue is donated to…

Q: ncentration of 3 X 10 M. Find the time required to convert 70% of substrate when Vmax = 2.167 M/min.…

A:

Q: In a gene mapping experiment, DNA from a prototrophic E. coli strain is transformed into an E. coli…

A: The correct answer is given below

Q: Classify attached radical as 1°, 2°, or 3°.

A: The type of radicals can be identified as

Q: Find the IHD and fragment/cleavage

A: The structure of the unknown molecule can be affirmed by analyzing the spectroscopical results such…

Q: 7. 116.5 ug of trypsin (MW 23.3 kDa) was mixed in a l ml solution with an excess of a peptide…

A: Hello. Since your question has multiple sub-parts, we will solve the first three sub-parts for you.…

Q: answer both. no need for detailed mech

A: Attack of cyanide to the keto carbonyl produce the cyanohydrin compound. The hydrolysis of nitrile…

Q: ANALYSIS The anticodon on one tRNA which carries histidine to the site of protein synthesis is CAU.…

A: Given information, The anticodon on one tRNA which carries histidine to the site of protein…

Q: HCI (b)

A:

Q: de Sn2 attack?

A:

Q: 17. An a helix or sheer is r exple A prinary semday peier arne wf ihes

A: 17.  The structute of protein is divided into 4 levels. Primary, secondary, tertiary and quaternary…

Q: NH2 H2N-DNA- H -N-DNA- H H2N-DNA- H2N OCH3 H2N. HN-DNA H3C NH H3C "NH2 Mitomycin C DNA adduct…

A: Reaction mechanism: A chemical reaction occurs by the sequence of elementary steps is called…

Q: Mohr's method is the adsorption method. Select one: O True O False

A: Ans is false . Explanation is given in 2 step.

Q: Poopose mechanlom for following transpormation ?

A:

Q: ing strands OT nds of the in the ce

A: This question is related to bonding.

Q: fter an electrophoresis experiment, how are the lengths of the DNA fragments in each lane…

A: Introduction : Gel electrophoresis is a method used to separate DNA fragments .

Q: Calcylafe the contentrafion , epuilibrivm congtant

A:

Q: tant peaks on the printed determined the Structural the printed

A:

Q: Draw a RAFT mechanism. Explain cross and self termination.

A: Applying concept of RAFT mechanism and their steps.

Q: What are annulenes ?

A: The compounds containing carbon and hydrogen only are termed as hydrocarbons. Hydrocarbons are…

Q: (b) Protein concentration can also be determined by UV spectrophotometry. (i) Describe the principle…

A: Answer. UV spectrophotometry or UV-Visible spectroscopy  is an analytical technique used to identify…

Q: Of the four DNA bases, why is guanine most likely to be modified after exposure to polycyclic…

A: DNA is made up of four bases-adenine, cytosine, guanine, and thymine. The pKa of adenine and…

Q: please help me identify the correct order for transcription, does the mrna strand get released in…

A: Transcription is the first step of gene expression which involves the formation of the mRNA strand…

Q: In SDS page, the elute from the column first. proteins will move through the gel fastest and first,…

A: SDS page and size exclusion chromatography are methods to separate proteins . In SDS page, charged…

Q: STRENGTH OF REACTION SAMPLE (small,med.large) +++ large bubbley Small bubbles mo reaction |LIVER…

A: To determine the catalase activity, we would first define what is catalase and then we would learn…

Q: What is NOT a feature of PCR? O a. The target can be much larger than the primers. Ob. Primers do…

A: the goal of PCR is to make enough of the target DNA region that it can be analyzed or used in some…

Photochemistry

Photochemistry is the part of chemistry that studies the various mechanisms of reactions that are triggered by the presence of light energy. It also helps to study the changes involved in a molecule that can undergo the absorption of radiation.