Once transcribed, the length of the mRNA for gene X is usually 1000 nucleotides long in your favorite bacterial species. After mutagenizing the bacteria, you notice that the mRNA is 800 nucleotides long. Which of the following could be the mutated that would explain your observations? a mutation introducing a new rut site in gene X a mutation in the Shine-Dalgarno sequence a mutation in the polyA addition site a mutation in the operator

Once transcribed, the length of the mRNA for gene X is usually 1000 nucleotides long in your favorite bacterial species. After mutagenizing the bacteria, you notice that the mRNA is 800 nucleotides long. Which of the following could be the mutated that would explain your observations? a mutation introducing a new rut site in gene X a mutation in the Shine-Dalgarno sequence a mutation in the polyA addition site a mutation in the operator

Name: Once transcribed, the length of the mRNA for gene X is usually 1000 nu
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Once transcribed, the length of the mRNA for gene X is usually 1000 nucleotides long in your favorite bacterial species. After mutagenizing the bacteria, you notice that the mRNA is 800 nucleotides long. Which of the following could be the mutated

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 8TYU: Which of the following is/are typically removed from pre-mRNA during nuclear processing in...

See similar textbooks

Similar questions

a. The reading frame DNA sequence is: b. The mRNA sequence is: c. The polypeptide sequence is: A disease in frogs which causes their tongue to fall out of their mouths is killing the frog population in LA County. You obtain a dead frog and isolate its gene Xf. When you sequence this mutated gene, you find that the last ‘G’ at the end of the first line of this sequence has been deleted (i.e. the G at position 86). In order to determine how this mutation changes the resulting polypeptide, write the mutated polypeptide sequence in the space below. What kind of mutation was produced? The mutated polypeptide sequence is What kind of mutation was produced?
The template strand of a gene contains the following sequence: 3'-TAC TTG TCC GAT ATC-5' Following a mutation, the sequence is modified for this one: 3'-TAC ATG TCC GAT ATC-5' Draw the sequence of a.a. encoded for each of the strands. What is the effect of this mutation on the sequence amino acids (specify type of mutation)
Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…
Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…
The figure shows the position of two of these mutations a and b. The nucleotides are altered in these 2 different swo-1 mutant alleles. Use the genetic table to describe any AA changes.Name the type of mutation and describe its effect on swo-1 mRNA and protein for each of the mutations. 3. The swo-1 a mutation (insertion between C and G). 4. The swo-1 b mutation (C-to-T mutation for indicated C). 5. The swo-1 a mutation leads to worms with more body wall muscle, whereas worms with the swo-1 b mutation are not able to move. Based on these phenotypes and the findings from questions 3 and 4, describe the role thewild-type version of this protein plays in muscle function.
Which type of mutation would expect would have no effect on a protein coding gene in eukaryotes? a.a single base substitution that creates a splice site mutation b.a single base substitution that creates a synonymous mutation c.a single base deletion that creates a frameshift near the 3' end of the open reading frame d.a single base substitution that creates a non-conservative missense mutation e.a single base substitution that creates a conservative missense mutation
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A missense mutation that is also a transversion
The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.
A human gene was initially identified as having three exons and two introns. The exons are 456, 224, and 524 bp,whereas the introns are 2.3 kb and 4.6 kb.a. Draw this gene, showing the promoter, introns, exons,and transcription start and stop sites.b. Surprisingly, this gene is found to encode not onebut two mRNAs that have only 224 nucleotides incommon. The original mRNA is 1204 nucleotides, andthe new mRNA is 2524 nucleotides. Use your drawing
Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is: 5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA 3’ What type of mutation has occurred? (max 1 sentence) Does this result in an amino acid change? If yes, identify the change that has occurred. (max 1 sentence) Based on your answer to Part 2, will this mutation impact the structure of the protein? Justify your answer. (1-2 sentences) Responding in point form is allowed!
As described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base sequence of a coding region changes by any number of bases other than three base pairs, or multiples of 3, a frameshift mutation occurs. Depending on the location of the sequence change, such mutations can have serious effects. The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUC-AUGUUU-3′ First, determine the amino acid sequence of the polypeptide. Then determine the types of mutation that have occurred in the following altered mRNA segments. What effect do these mutations have on the polypeptide products? a. 5′-AUGUCUCCUACUUGCUGACGAGGGAAGGAGGUGGCUUAUCA-UGUUU-3′ b. 5′-AUGUCUCCUACUGCUGACGAGGGAGGAGGUGGCUUAUCAU-GUUU-3′ c. 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCCCUUAUC-AUGUUU-3′ d. 5′-AUGUCUCCUACUGCUGACGGAAGGAGGUGGCUUAUCAU-GUUU-3′
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?