Plus pole pH 11.0 Middle of Paper Minus pole Aspartate Lysine Leucine Histidine Example amino acic
Q: a) Which of these contration of all substrates and enzymesed state of a biological system? a) There…
A: The term "standard conditions" in biology typically refers to a set of reference conditions that are…
Q: In this problem consider how Glycine's charge changes with pH. You can find the pKas for the alpha-…
A: Glycine is the smallest of the twenty amino acids found in proteins. It has a simple structure with…
Q: Identify the amino acid(s) present in this structure. isoleucine Ophenylalanine valine cysteine…
A: The molecule in question is a dipeptide i.e. 2 amino acids joined together via a peptide bond. In a…
Q: Which of the following statements about ion channels is incorrect? Channel proteins are used…
A: Channels are membrane proteins that allow biomolecules such as glucose or water or ions to pass…
Q: Compounds having the same structural formula but differing in spatial configuration are known as (A)…
A: This answer aims to clarify the difference between four terms related to stereoisomers:…
Q: Which of the following condenses acyl and malonyl groups? a) Acetyl co-A ACP transacetylase b)…
A: β-ketoacyl ACP synthase is an enzyme that plays a critical role in fatty acid biosynthesis. It…
Q: 25) Below are two amino acids: cysteine and histidine. a) Draw the reaction mechanism of a…
A: A peptide bond is formed between the carboxyl group of N-terminal amino acid residue and the amino…
Q: 9. Sulphur containing amino acid is (A) Methionine (B) Leucine (C) Valine (D) Asparagine
A: The above answer explains why Methionine is the correct answer to the question "Sulphur containing…
Q: 11.30) Identify the following as properties of amylose, amylopectin, both amylose and amylopectin,…
A: Polysaccharides are complex biomolecules composed of carbohydrates made up of long chains of…
Q: Which of the following is required for crystallization and storage of the hormone insulin? (A) Mn++…
A: The question asks about the mineral required for the crystallization and storage of the hormone…
Q: Determine if the following salt is neutral, acidic or basic. If acidic or basic, write the…
A: A salt is said to be acidic when it is made by the reaction of a strong acid and a weak base. When…
Q: Directions: Explore PDB Statistics using the data tables and answer the following questions: 1.…
A: RCSB-PDB stands for Research Collaboratory for Structural Bioinformatics-Protein Data Bank. This…
Q: Reductive power. What ratio of NADPH to NADP+ is required to sustain [GSH] = 10 mM and [GSSG] = 1 mM…
A: Within a cell, reactive oxygen species are produced as a byproduct of oxygen metabolism and the cell…
Q: Which of the following is involved in the bio-signaling pathway that includes membrane turnover and…
A: Phosphatidylinositol (PI) is a phospholipid that is found in the cell membrane of eukaryotic cells.…
Q: OH NaOH
A: Fatty acids are long chain carboxylic acids. Here we are looking at the reaction between a free…
Q: Glucose-6-phosphate dehydrogenase catalyzes the first step of the pentose phosphate pathway. This…
A: Km of an enzyme is the measure which gives an idea of a substrate's affinity towards its enzyme. It…
Q: 5.1 What regulatory mechanisms control TCA cycle? How does these mechanisms respond to changes in…
A: The TCA cycle, also known as the citric acid cycle or Krebs cycle, is a series of biochemical…
Q: Explain about Renin-Angiotensin system and Hyponatremia
A: The Renin-Angiotensin System (RAS) is a physiological pathway that helps regulate blood pressure,…
Q: Calvin-Benson Cycle EC Ribulose-1,5-bisphosphate carboxylase 4.1.1.39 oxygenase Enzyme…
A: The Calvin cycle is a process done by photosynthetic plants for carbon dioxide fixation. Here,…
Q: The optically inactive amino acid is (A) Glycine (B) Serine (C) Threonine (D) Valine
A: The question asked to identify the optically inactive amino acid among four options: glycine,…
Q: a) The molecule below is a/n: amino acid dipeptide tripeptide (circle one) b) Would the molecule…
A: Biochemically, amino acids are biomolecules with a carboxyl group, an amino group and a chemically…
Q: Write a balanced equation showing the effect of simultaneous activation of glycogen phosphorylase…
A: Glycogen metabolism involves the conversion of glycogen into glucose 1-phosphate and the synthesis…
Q: How many Calories should there be in three grams of pure sucrose? C. 18 A. 4 B. 12 D. 8 E. M
A: Sucrose, the common sugar, is a disaccharide made up of glucose and fructose linked via a 1-1…
Q: The individual hemoglobin subunits and myoglobin share similar ________ structure but have rather…
A: Heme proteins that act as oxygen binding proteins are haemoglobin and myoglobin. The fundamental…
Q: dentify the following as properties of either glycogen, amylopectin, both glycogen and amylopectin,…
A: Polysaccharides are complex biomolecules composed of carbohydrates made up of long chains of…
Q: Results in 8 10 T cell receptor complex Binds to 6 Results in H Activated ZAP-70 phosphorylates…
A: T-cells, also known as T-lymphocytes, are a type of white blood cell that play a critical role in…
Q: 9) Epinephrine is synthesized from a. Tyrosine b. Tryptophan c. Glutamine d. Asparagine e. Glycine
A: Epinephrine, also known as adrenaline, is a hormone and neurotransmitter produced by the adrenal…
Q: 11. Which of the following phospholipids is localized to a greater extent in the outer leaflet of…
A: The distribution of phospholipids in the membrane lipid bilayer is asymmetric, meaning that certain…
Q: 21. Dietary Sources, RDA factors affecting absorption, functions and deficiency manifestations of…
A: In this answer, we will discuss the important mineral calcium, which plays a crucial role in…
Q: 2. Describe biosynthesis of heme with its disorders.
A: This answer aims to provide a comprehensive overview of the biosynthesis of heme, along with the…
Q: Which of the following is the correct sequence for the movement of electrons during the…
A: During the light-dependent reactions, light energy is absorbed by photosystems I and II (PSI and…
Q: Please explain the significance of this diagram with respect to cancer/tumor development. Tumor…
A: Let us first understand the metabolism for energy production in cell. In any cell, glucose is the…
Q: Sketch an illustrated model of a fatty acid micelle and label the polar and non polar parts
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. they…
Q: raw TCA Cycle. Please make sure to state all the enzymes and co-factors for each step of the…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate. It…
Q: H₂N. OH + H₂N. OH enzyme
A: Here we are looking at an enzyme catalyzed reversible reaction between 2 amino acids, alanine and…
Q: Could you help me with the remaind of the reactions F to H? See picture of the mechanism below.
A: In arrow pushing mechanism: the tail of the arrow represents where the electrons are coming from…
Q: Treatments for urea cycle enzyme deficiencies summarize deficiencies and the strategies for…
A: The urea cycle is a metabolic process that plays a crucial role in removing toxic ammonia from the…
Q: The catalytic triad consists of Asp, His, and Ser. What would be an alternative for histidine and…
A: The catalytic triad is a group of three amino acid residues found in many enzymes, consisting of…
Q: What principles define large polysaccharides, proteins, and nucleic acids?
A: Polysaccharides are large molecules formed by carbohydrates. Proteins are large molecules formed by…
Q: Dehalogenase enzymes catalyze the clevage of C-X bonds. One such dehalogenase catalyzes the…
A: A dehalogenase enzyme removes a halogen atom from a substrate. It is found in certain bacteria such…
Q: 3. pH (isoelectric pH) of alanine is (A) 6.02 (B) 6.6 (C) 6.8 (D) 7.2
A: The question asked about the isoelectric pH (pI) of alanine, which is the pH at which the molecule…
Q: What is the significance of gene expression in biochemical processes?
A: Gene expression, as the name suggests, is the 'expression' of genes by forming products such…
Q: 1. The initial rate of an enzymatic reaction was determined at different substrate concentrations.…
A: Enzyme kinetics is the study of the rate at which enzymes convert substrates into products, as well…
Q: Glucose 6-phosphate can be used for other purposes apart from energy production_ Which of the…
A: Once inside the cell, glucose is phosphorylated by hexokinase to prevent it from leaving the cell.…
Q: Select all of the following that accurately apply to acyl-CoA synthetase and the transport of…
A: Fatty acids are often stored in cells in the form of triglyceride. When fatty acids are required by…
Q: The graph below is a standard curve generated by plotting the distance travelled by the size…
A: The standard curve generated for an analysis involving separation of proteins along the SD-PAGE gel…
Q: Which one of the following statements best describes why champagne is extremely bubbly? Fermentation…
A: Champagne is alcoholic beverage produced by fermentation of grape juice by yeast. In absence of…
Q: describe the role of mitochondria in initiating apoptosis. please describe and summarize in short…
A: Apoptosis, also known as programmed cell dress, is a natural process by which cells degrade their…
Q: Why is there a difference between the stock solution concentration of chymotrypsin calculated from…
A: Chymotrypsin is a proteolytic enzyme, that is, it cleaves peptide bonds via hydrolysis. It is…
Q: 3. Which statement is true regarding this disaccharide? A. It's the a-anomer. B. The linkage is…
A: If the C6 and the OH bonded to C1 of a hexose are on the same side of the ring, then the hexose is a…
Step by step
Solved in 3 steps with 1 images
- Explain the Rf value obtained on the basis of the structure of amino acids use. Explain in 1-3 sentence only.REFECT AND APPLY Answer Question 30 using one-letter designations for the amino acids.Using the nucleotide sequence of an accession number (NM_019121) what is the translatedamino acid sequence (only the original sequence, not the frameshifted or reversecomplements sequences)?
- Calculate the overall net charge of the following polypeptide at pH = 2.0Gly-Pro-Glu-Asp-Leu-His-Ile-Gln-Asn-Phe A) +1.76 B) -1.76 C) +0.24 D) -0.24What is the TOTAL NET CHARGE of a free arginine amino acid at pH = 12.5?Determine the pI of the peptide H2N-Ala-Lys-Ser-Arg-COOH at pH 11, please explain why some pKas are used in the solution of the problem while others are not.
- High salt concentrations tend to cause protein aggregation. Suggest a way to identify proteins normalexpressed in particular bacterial species that can retaintheir solubility despite high salt conditions.Please draw the titration curve Arginine (y-axis: pH, x-axis: moles of OH-). Label the graph with the pKas and pI of the amino acid. Also, draw the species of the Arginine along the titration.what amino acid is found at the resiue position 58 of 3GRS glucathione reducatse and why is this poisiton important in the protein?
- Draw the structure of the tri-peptide Leu-Asn-Ser at pH 7.4. Use wedges and dashes around the alpha-carbons, and indicate charges where appropriate. Indicate which amino acid(s) has an R group that would avoid water.using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error on the amino acid chain?Identify the structure of the predominant form of the pentapeptide at pH = 12 if there is a pentapeptide Ile-Lys-Asp-Phe-Gly
