Question 1 During nucleic acid hybridization, the probe is labelled for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2
Q: Why are cell membranes disrupted by soap?
A: Please note that of the two unrelated questions posted together, the first one has been answered…
Q: Which of the following method can cause plasmid DNAs to be uptaken by the bacteria cells?…
A: A plasmid is a small double-stranded DNA unit that exists independently of the chromosome and is…
Q: Question 35 This enzyme is responsible to cleave the sugar–base bond to delete the modified…
A: Enzymes are special protein molecules used to catalyse a biochemical process in the body. In…
Q: Hyrolysis of DNA Test Results 1. Inorganic Phosphate 2. Purines 3. Deoxyribose
A: Hydrolysis of DNA will cause the DNA backbone to break down and ultimately give the deoxyribose…
Q: What is experiment of Thermodynamics of Small Oligomeric Duplex DNA Denaturation.
A: Double-stranded DNA is the most common kind of DNA molecule found in nature. The strands can be…
Q: when measuring the purity of a DNA sample? Please select the single answer that is most correct.
A: An instrument called spectrophotometer is able to measure the absorbance of specific wavelength of…
Q: Question 1 DNA replication is said to be semi-conservative because Question 1 options: each…
A:
Q: Please answer the following using the experiment data below. Provide the formulas or methods used…
A: Transformation efficiency is defined as the number of colonies obtained per microgram of DNA plated.
Q: di-deoxy nucleotides terminate DNA elongation in Maxam-gilbert method. True False
A: First-generation DNA sequencing methods include Maxam–Gilbert sequencing and the Sanger method.…
Q: Can you please check my answer and make sure it is correct. Question: Describe the two roles…
A: Primers provide specificity for amplification of the target sequence. They are typically 18-30…
Q: The rate of migration of DNA within an agarose gel in the gel electrophoresis technique is primarily…
A: How size determine the rate of migration:- Smaller DNA molecules migrate Faster through the gel.…
Q: What are the roles of the following reagents in DNA extraction? a. Ethanol b. NaCl c. SDS d. TE…
A: A) The initial role of the ethanol and monovalent cations is to remove the solvation shell…
Q: Question 1. Restriction endonucleases can be isolated from a number of bacteria. In bacteria…
A: Restriction endonucleases are DNA cutting enzymes. They cleave the DNA at or near specific sequence…
Q: During nucleic acid hybridization, the probe is labelled O for DNA stability O to increase…
A:
Q: True or false: During DNA isolation, ice cold 95% ethanol is used to digest the DNA into fragments…
A: During DNA isolation 95% ethanol is used for DNA precipitation not for DNA digestion and while we…
Q: All of the following are examples of materials that are bound by your purifying medium during the…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Loading dye stains the DNA molecules and thus help to visualize it under UV light apparatus. O True…
A: DNA Loading dye is used to monitor the migration of DNA into the gel during electrophoresis.…
Q: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting…
A: The recombinant DNA technology (cloning) is used for the production of insulin, growth hormone (GH),…
Q: You will be setting up your diagnostic digest on three plasmids, the ones you began with, PGFPUV and…
A: In this question, we have to complete the table for the reaction mixture of a PCR experiment.
Q: DNA concentration in cuvette solution (in microgram per ml) Dilution factor of DNA sample in cuvette…
A: DNA is the nucleic acid and it absorbs the UV light with maximum absorbance at 260 nm wavelength due…
Q: What is the difference between SDS-PAGE and 2D electrophoresis
A: SDS-PAGE AND 2D electrophoresis- Both are isoelectric focusing mean also known simply as electro…
Q: Compare and contrast the running buffers for DNA and protein electrophoresis.
A: Electrophoresis- Electrophoresis is a method that separates macromolecules-either nucleic acid or…
Q: QUESTION 7 Primers are needed to start a PCR reaction True O False QUESTION 8 Restriction enzymes…
A: Introduction:- Restriction enzyme is a protein that recognise a specific, short nucleotide sequence…
Q: During gel electrophoresis, in what direction (toward which electrode) does DNA move toward?…
A: There are different molecular biology tools and techniques used to analyze and quantify…
Q: Following is the DNA repair mechanism for double stranded DNA damage: Question 33 options: Base…
A: Any of numerous ways by which a cell maintains the integrity of its genetic code is known as DNA…
Q: QUESTION 4 Which of these is not a component of the plasmid cloning vector O a. tetR O b. lacZ gene…
A: A vector is a tool to replicate foreign DNA into a host organism with the help of recombinant DNA…
Q: QUESTION 1 Match the discovery with the individual or groups that discovered it. (names may be used…
A: Introduction DNA:- It is a long molecule that contains our unique genetic code, It transmits the…
Q: 0.175mm e O In the DNA extraction experiment, the separation of DNA from its packaging protein can…
A: Introduction DNA is crucial biomolecule which serves as genetic material in most of the living…
Q: During nucleic acid hybridization, the probe is labelled Question 1 options: for DNA stability to…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Statement 1: Gel electrophoresis separates macromolecules like DNA and proteins according to the…
A: A molecular technique commonly used for the separation of proteins based on mass is called SDS-PAGE…
Q: Question 3 Based on the animation. DNA is a right handed double helix. O True O False
A: Deoxyribonucleic acid is a molecule consist of nucleotide in which contain sugar, phosphate group…
Q: What do you mean by amphoteric substance? Give examples of substance that is/are amphoteric. What…
A: Biochemistry is the study of biochemical functions at the cellular and molecular level using…
Q: Question one: PCR You want to amplify the underlined sequer 1) Design Forward and Reverse primers 2)…
A: PCR in Polymerase Chain Reaction which is used for the amplification of a given molecule of DNA.
Q: Question 5 Match the following components with the biotechnology technique they play a role in.…
A: Recombinant DNA technology is a technique by which foreign DNA is introduced into the host. DNA…
Q: Results obtained from a Nano Spec. DNA samples collected: ng/uL A260/A80 A260/A230 E.coli genomic…
A: Beer-Lambert Law is applied in absorption spectrometry for biochemical analysis of various…
Q: 22.124 Give two reasons why bacterial cells are used for recombinant DNA procedures. 22.125 What…
A: In recombinant DNA technology, the molecules of the DNA will join together through insertion from…
Q: question on plasmid minipreps and restriction digestion How does this procedure allow you to purify…
A: Plasmids are extrachromosomal circular molecules of double stranded DNA which can replicate…
Q: What technique was used to photograph DNA in franklins famous photo #51? A- gamma ray photography B-…
A: Imaging with gamma rays is used in nuclear medicine, as well as in court medicine. This technique…
Q: What are the importance of accurate wavelength measurement in purified DNA sample? Explain why…
A: DNA can be extracted by using different protocols. Protocols of DNA isolation are modified according…
Q: Process of Dpph free radical scavenging assay
A: DPPH free radical scavenging assay is a fast, basic, reasonable and broadly utilized technique to…
Q: Double stranded DNA is denatured in the presence of high heat low heat high pressure acidic…
A: According to Bartleby guidelines , we are required to attempt first question in case of multiple…
Q: DNA EXTRACTION Materials: knife 1…
A: DNA extraction: It is the method used for the plants and animals both. It is the most recent and…
Q: QUESTION 3 Look at the following piece of DNA cut with enzymes I and II, crating 3 fragments; A, B…
A: Agarose gel electrophoresis isca technique used to seperate the DNA molecule based on their…
Q: These questions relates to DNA extraction, the choices are in the attached photos (i) Sanger…
A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…
Q: Based on the quantitation data, please indicate how you would dilute the following samples. Fill in…
A: DNA shows maximum absorbance at the wavelength of 260 nm. Hence the concentration of DNA in solution…
Q: What part of the PCI Method of DNA extraction explains the: Cell Lysis Separation Precipitation
A: PCI DNA extraction method uses phenol, chloroform, and isoamyl alcohol as three basic ingredients to…
Q: In which reagent is extracted DNA suspended to put it in solution? O Sodium dodecyl sulfate (SDS) O…
A: Introduction DNA extraction is a method to isolate DNA in a biological sample, which is done by…
Q: Cause and Effect Determine the effect (increase, decrease, no effect or cannot be determined) of the…
A: * Salt is used in process of DNA extraction because salt it will neutralizing DNA that makes them…
Q: Why do scientists isolate DNA?…
A: There are different techniques to study DNA and gene present in it.
Step by step
Solved in 2 steps
- Which of the following pairs of sequences would be considered different alleles in DNA profiling? a) ATGAATTCGG; ATGAAATCGG b) ATGAATTCGG; TACTTACTTACT c) GAAGAAGAA; GAAGAAGAAGAA d) AATAATAATAAT; AATTAATTAATTChoose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OHHUMAN KARYOTYPE ANALYSISAnswer the following questions based on the given karyotype below:(see attched) a. What is the chromosome number of the individual? ___________________b. Give the sex of the individual. ______________c. Based from the karyotype, identify the name of the genetic condition of the individual. Listdown two (2) distinctive characteristics of the affected individual.
- A blood stain from a crime scene and blood samples from four suspects were analyzed by PCR using fluorescent primers associated with three STR loci: D3S1358, vWA, and FGA. The resulting electrophoretograms are shown below. The numbers beneath each peak identify the allele (upper box) and the height of the peak in relative fluorescence units (lower box). Solve, (a) Since everyone has two copies of each chromosome and therefore, two alleles of each gene, what accounts for the appearance ofonly one allele at some loci? (b) Which suspect is a possible source of the blood? (c) Could the suspect be identifi ed using just one of the three STR loci? (d) What can you conclude about the amount of DNA obtained from Suspect 1 compared to Suspect 4?please help me! THANK YOU! In not more than 30 words explain the relevance of a chi-square test in genetics.Please answer all parts along with the reason. I'll definitely give a like. Thank you in advance! 1A) From the cross Ab/aB x ab/ab, what is the recombination frequency if the progeny numbers are 17 AB/ab, 72 Ab/ab, 68 aB/ab, and 21 ab/ab? 1B)In human gene mapping, a LOD score is calculated to see if a gene causing a rare disease is linked to a known SNP. The LOD score is -4. This means that 1C) A three-point testcross is used to determine the order of three linked genes. The following crossover progeny result: single crossovers, double crossovers, and no crossovers. To determine the order, the no-crossover progeny must be compared to what other class of progeny?
- DNA fingerprinting and Restriction Fragment Length Polymorphism (RFLP) analysis are often used to test for paternity. A child inherits chromosomes from both mother and father, so DNA from a child displays restriction fragments derived from each parent. In the gel shown below, which child, if any, can be excluded as being the biological offspring of the putative father? Lane M is the sample from the mother, F from the putative father, and C1, C2, and C3 from the childrenDNA fingerprinting questions: ( Please label each lane so I know which one you refer to) Please explain vividly so I can understand: •Explain each lane, by analyzing the band pattern and concluding whether it's homozygous or heterozygous for the presence of Alu at the PV92 locus. •Literature states Alu insertions at PV92 locus are most common in the Asian population (+/+) and mostly not found in Europeans, Americans (-/-) Reference: https://www.mediafire.com/file/s3nr36ow4bw4udw/DNA+Fingerprinting.docx/fileThe results of a paternity test using short tandem repeatsare listed in the table below. Who’s the daddy? How sureare you?
- For the given restriction enzyme: BslI (CCNNNNN^NNGG) i) Approximately how many fragments would result from digestion of the human genome (3 × 109 bases) with the enzyme? ii) Estimate the average size of the pieces of the human genome produced by digestion with the enzyme. iii) State whether the fragments of human DNA produced by digestion with the given enzyme would have sticky ends with a 5′ overhang, sticky ends with a 3′ overhang, or blunt ends. iv) If the enzyme produces sticky ends, would all the overhangs on all the ends produced by that enzyme on all fragments of the human genome be identical, or not? The recognition sequence on one strand for the enzyme is given in parentheses, with the 5′ end written at the left. N means any of the four nucleotides; R is any purine—that is, A or G; and Y is any pyrimidine—that is, C or T. ^ marks the site of cleavage. Note that the recognition sites containing Ys and Rs are not always rotationally symmetrical.Choose the phrase from the right column that best fitsthe term in the left column.a. DNA polymorphism 1. DNA element composed of shorttandemly repeated sequencesb. phase 2. two different nucleotides appearat the same position in genomicDNA from different individualsc. informative cross 3. arrangement of alleles of twolinked genes in a diploidd. ASO 4. location on a chromosomee. SNP 5. a DNA sequence that occurs intwo or more variant formsf. DNA fingerprinting 6. a short oligonucleotide that willhybridize to only one allele at achosen SNP locusg. SSR 7. detection of genotype at anumber of unlinked highlypolymorphic locih. locus 8. allows identification of a gamete asrecombinant or nonrecombinanti. compound 9. all exons in a genomeheterozygotej. exome 10. individual with two differentmutations in the same geneShown below are several next-generation sequencing reads from a sample you have. Which of the following is the most likely candidate for the original linear piece of DNA present in the sample that created the sequence reads shown below? 5' GGGCATTA 3' 5' TACGAACA 3' 5' ATACCGGGC 3' 5' ACCGTACG 3' 5' AACATACC 3' Question 4 options: 5' ATTAACCGTACGAACATACCGGGC 3' 5' GGGCATTATACGAACAATACCGGGC 3' 5' ACCGGGCATTAACCGTACGAACAT 3' 5' AACATACCGGGCATTAACCGTACG 3' 5' GGCATTAACCGTACGAACATACCG 3' 5' ACCGTACGAACATACCGGGCATTA 3'