Q: Why does heat denature, or melt, DNA in solution?
A: DNA or deoxyribonucleic acid is the genetic material of most of the organisms except RNA viruses. It…
Q: Which of the following ingredients does not belong in a sequencing reaction? (A ddNTPs B Primer C…
A:
Q: What causes the DNA to migrate from the wells toward the positive electrode? a) DNA is positively…
A: ANSWER;- b) DNA is negatively charged, and so was attracted to the positive electrode Explain;- DNA…
Q: Determine the chemical reagents utilized in banana DNA extraction and their roles. What role does…
A: 3. Liquid dishwashing soap This helps split apart the cell membrane made of lipids and the cell…
Q: In DNA extraction what else might be in the ethanol/aqueous interface? How could you eliminate it
A: Monovalent cations and ethanol play a key role in removing the solvation shell that surrounds DNA,…
Q: Why is it important to use a hyperthermophilic DNA polymerase in PCR? a) Because only…
A: PCR polymerase chain reaction is a biotechnology technique used for amplification of DNA.
Q: In DNA extracting. What is the purpose of clear shampoo in the DNA extraction buffer?
A: DNA is extracted from different sources to analyze and study the DNA sequence and diseases caused…
Q: Describe the processes involved in denaturing and renaturing of DNA, and explain what is useful…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…
Q: During gel electrophoresis, DNA fragments are separated such that the longest DNA samplas migrate…
A: It is false The true statement is- during gel electrophoresis DNA fragment are separated such that…
Q: Explain the principles of DNA migration of sample A in the electrophoresis experiment
A: Electrophoresis is a separation technique that was used to separate the mixture of molecules from a…
Q: Write down the causes and solutions of the following problems encountered in DNA isolation. 1- low…
A: LOW DNA CONCENTRATION. The common cause for low DNA concentration are poor culturing…
Q: Each cycle of amplification in PCR involves all of the steps EXCEPT: A annealing of…
A: In the 1980s, Kary Mullis developed the PCR (Polymerase Chain Reaction) method. PCR makes use of DNA…
Q: SNP-chips are used ____. a. with short tandem repeat profiling b. to sequence DNA. c. in…
A: SNP array is very useful tool for study of slight variations between whole genomes.The most…
Q: Which of the following is most needed to determine the DNA quantity using the eyeball method? A DNA…
A: DNA quantity was determined by several methods where absorbance was one of the widely used methods…
Q: Identify the solution component that contains the extracted DNA.
A: Ethanol precipitation method is generally used for DNA extraction.
Q: Which of the folllowing is the term used for ultra compact form of DNA coiling? a. supercoiling…
A: Compacting DNA is important for packaging it within the cells. As the length of a DNA molecule can…
Q: What is the use of Liquid soap in DNA extraction?* A. binds cell membrane and nuclei B. dissolves…
A: DNA extraction is a process of extracting DNA from the cell for further experiments. It is a method…
Q: When working with the gel electrophoresis chamber, what must we keep in mind? A. Keeping the gel…
A: Gel electrophoresis technique of separation of molecules on the basis of their size and charge under…
Q: What will happen to the concentration and the A260/280 ratio of the DNA sample in the following…
A: Biotechnology is the use of our understanding of biological processes to develop useful applications…
Q: Can DNA be isolated from beef? Discuss the process briefly
A: The purification of DNA from the collected sample of DNA with the help of the various methods and…
Q: Explain the importance of adding TE Buffer as the final solution to isolate the concentrated DNA.
A: DNA isolation is a process of extracting nuclear material from a tissue sample. The tissue sample is…
Q: Describe the possible outcome of a PCR experiment in which (a) one of the primers is inadvertently…
A: The polymerase Chain reaction is molecular biology in vitro technique to make multiple copies of a…
Q: When we discuss PCR and other similar techniques, the term Tm is often used. This refers to a.The…
A: PCR ( Polymerase Chain Reaction) is a technique in which numerous copies of genetic material (…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…
A: DNA (deoxyribonucleic acid) is a double-stranded nucleotide sequence that is intertwined and…
Q: If a uidA amplicon generateed by PCR is 200bp and the DNA fragments resulting from the restriction…
A: INTRODUCTION Polymerase Chain reaction This is the method of amplification of of nucleic acids such…
Q: In which reagent is extracted DNA suspended to put it in solution? A. Sodium citrate saline buffer…
A: In which reagent is extracted DNA suspended to put it in solution? A. Sodium citrate saline…
Q: What happens if you forget to add Sybrsafe to a gel that will be used for DNA gel electrophoresis…
A: Gel electrophoresis is a gel technique that separates DNA and proteins based on their mass, by means…
Q: In a protocol for DNA sample preparation for agarose gel electrophoresis, what volume of 4X loading…
A: Electrophoresis It is a biochemical technique to separate charged molecules under the influence of…
Q: what happens to the intactness of DNA if extracted DNA fibers were placed in buffer of pH 3?
A: Extracted DNA is generally stored in neutral pH.
Q: Which of the following does the enzyme primase synthesize? a. DNA primer b. RNA primer c. Okazaki…
A: Primer RNA is RNA that initiates DNA synthesis. Primers are required for DNA synthesis because no…
Q: Describe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in…
A: The polymeric chain reaction (PCR) is a technique in which amplification of a specific DNA segment…
Q: What are the principles of Chelex extraction and solid-phase DNA extraction methods?
A: To explain the principles of Chelex extraction and solid-phase DNA extraction methods The principle…
Q: In the DNA extraction. What is the role of alcohol in the DNA extraction process?
A: DNA extraction involves collecting all the DNA from a cell. For that, we first prepare the cells…
Q: State the function of each chemical/components below in DNA extraction Salt: Detergent:…
A: Breaking cells open to release the DNA. Separating DNA from proteins and other cellular debris.…
Q: What is the purpose of Bromophenol Blue in electrophoresis? a. To follow the progress of the gel as…
A: Introduction The technique of gel electrophoresis is used to separate DNA fragments based on their…
Q: These are the questions choices are given below (i) What is the purpose of adding table salt (NaCl)…
A: *DNA IS POSITIVELY CHARGED. *Protiens ( histones) are NEGATIVELY CHARGED *Adding NaCl or table…
Q: Use a drawing to illustrate the principle of DNA gel electrophoresis. Indicate roughly the…
A: Gel electrophoresis technique is used to separate DNA, RNA and proteins depending on their molecular…
Q: DNA could be denatured without maximum damages a. NaCl b. High heat c. NaOH d. Na-acetate
A: The process of separation of double stranded DNA (dsDNA) into single strands by physical or chemical…
Q: You have two DNA samples, A and B. A 1/10 dilution of sample A had an absorbance at 260nm of 0.12. A…
A: Nucleic acids strongly absorb UV light with wavelengths of 260 nm due to the resonance structure of…
Q: Some recombinant DNA techniques depend on the specific hybridization (or annealing) between two…
A: The invention of recombinant DNA technology was carried out by Herbert Boyer & Stanley & N.…
Q: For DNA amplification using PCR to occur, which of the following are needed? A. DNA primers…
A: The term polymerization stands for the production of a large chain or network-like molecules, from a…
Q: What is the purpose of adding table salt (NaCl) to the DNA extraction buffer?
A: The deoxyribonucleic acid (DNA) carries the genetic information and is usually present in the…
Q: In the isolation of DNA which of the following best describe the purpose of using NaCl-SDS solution?
A: DNA extraction is a technique for separating DNA from cell membranes, proteins, and other cellular…
Q: Consider the four extraction/purification methods . a. Which extraction method would you use for a…
A: DNA isolated from various biological samples can be used for a vast array of downstream…
Q: Which of the following is the correct order in extracting the DNA? I. Washing of DNA II. Tissue…
A: DNA act as genetic material in most of organism . It is two stranded , ladder like structure . DNA…
Q: Given the electrophoresis profile of a Sanger sequencing result, what was the sequence of the…
A: The correct option is b 5'CCATTGG3'. Sanger sequencing ( method of DNA sequencing and it involves…
Q: What are the different methods of quantifying DNA? How would you determine if your
A: Quantitation of DNA ,methods used for quantifying DNA ---* Quantifying of DNA -- In various methods…
Step by step
Solved in 2 steps
- The following question is related to Restriction Enzymes and RFLP. Using EcoRl, how many fragments were PRODUCED in DNA sequence A? A.) 2 B.) 3 C.) 4In DNA extraction where ethanol was used why does the DNa floatExplain the importance of adding TE Buffer as the final solution to isolate the concentrated DNA.
- What will happen to the concentration and the A260/280 ratio of the DNA sample in the following scenarios? a)Add to low % ethanol. b) Add too little salt. C) Forget to boil the sampleWhat are the DNA extraction methods? Explain each one.Which of the following correctly describes a possible scenario during a run of gel electrophoresis with DNA samples?