The polypeptide chains in insulin are held together by hydrogen bonds  Group of answer choices True False

Q: 4. Liver alcohol dehydrogenase (LADH) catalyzes a reversible, pH-dependent oxidation of an alcohol…

A: Density=massvolumeDensity of methanol=mass of methanolvolume of methanol0.79 g/ml=mass of…

Q: List the key challenges in the biosynthesis phosphatidylcholine.

A: The most common PL identified in circulating VLDL is phosphatidylcholine (PC) . PC is produced in…

Q: 4. The enzyme abundantly distributed in adipocytes and germinating seeds are A. proteases B. lipase…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Using the concept of complementary base pairing, write the complementary DNA strands, with their 5'…

A: The DNA molecule generally has two strands that wind around one another to form a shape is generally…

Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…

A: Enzymes are biocatalysts that increase the rate of a reaction by a factor of several. Living cells…

Q: In a 25 uL reaction, you desire a buffer concentration of 1X. You will be supplied with a stock…

A: Dilution of buffer solution or any solution can be done to obtain a diluted solution with varied…

Q: Test Results + or -? Points awarded Code Glu – acidic end products yellow ______ _____+ Glu – gas…

A: Introduction: Microbial metabolic processes are complex but still, it permits the microbiologist to…

Q: You'lre hungoy, body Cmuttiple g the following e optim posei ble) which Occur in Our toonelete (A) À…

A: Hungryness is a feeling that stimulates food intake. There are number of pathways that stimulate…

Q: Question 17 In a glucometer, glucose oxidase catalyzes the redox reaction of glucose to form…

A: Glucometer is the instrument used to measure and display the amount of glucose level in the blood.…

Q: 13. Which of the following is an example for derived lipids? A. steroids B. terpenes C. carotenoids…

A: Hi! Since you have posted multiple question, we shall answer the first question for as we are only…

Q: GLUCONEOGENESIS Reactant Coenzyme/ Product Cofactor Enzymes

A: The balance between the rate of glucose leaving and entering the blood circulation…

Q: How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed…

A: Protein synthesis occurs in four main steps such as activation or charging of tRNA, initiation of…

Q: When comparing two or more ligands, a larger numerical value for KD corresponds to a higher binding…

A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…

Q: Why aren’t your cells poisoned to death even though they create toxins like hydrogen peroxide?

A: The hydrogen peroxide formed produced during normal cellular metabolism. It is a potent toxin that…

Q: Indicate a positive result with a (+) sign, and a (-) if otherwise. A triple (+) may be used to…

A: Molisch’s test - is used to detect carbohydrates. Molisch test gives positive for all carbohydrates…

Q: ideroblastic anemia is observed in the deficiency of which of the following? * (Please choose one…

A: Vitamins are the organic compounds required for the proper functioning of the body. The vitamins are…

Q: Under what conditions will lactic acid accumulate in skeletal muscle? Select one: A. When NADH is…

A: A reduction in muscle force generated over time or as a result of pathological conditions is…

Q: Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate…

A: As given in the question, the concentration of each reactant, i.e., Pyruvate and NADH, and products,…

Q: From the diagram to the right of the trp repressor in its (i) approximate binding relationship to a…

A: Given Figure shown trp repressor protein bond to DNA double strand. Protein is mainly comprised of…

Q: Colchicine is used to treat gout. It alters cytoskeleton function. Why do you think it is useful for…

A: Gout is a frequent and complicated form of arthritis that can strike anyone at any time. It's…

Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…

A: DNA strand given here with directionality is as: 5’…

Q: fat excess from the liver) in initial stages of liver cirrhosis, toxic liver lesions, and chronic…

A: Since, you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: What amino acid residues interact with methylphenidate in DAT and NET protein active sites? please…

A: DAT and NET proteins are  Dopamine Transporter and NET is Nor-Epinephrine Transporter proteins, both…

Q: 3. When the cellular energy charge is high the cells diverts into fatty acid synthesis. A. pyruvate.…

A: Glucose is the primary source of energy for the body. Glucose is metabolized through the glycolytic…

Q: Functional group as indicated by letters A,B,C and D?

A: Tamiflu is a drug made from the starting molecule shikimic acid. Tamiflu is a prodrug usually used…

Q: 6. The synthesis of fatty acids depends on the sequential transfer of three carbon malonyl-groups…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Please discuss how digitoxin provides a positive inotropic effect and is used to treat congestive…

A: Digitoxin is  a cardiac glycoside that is used in the treatment of heart failure. Glycoside are…

Q: What are the biochemical test used to assay fatty acids and cholesterol?

A: Fatty acids are carboxylic acid derivative of aliphatic chain hydrocarbon. It can have long or short…

Q: 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach…

A: Hemoglobin is a conjugated protein with four polypeptide chains. It contains two identical alpha and…

Q: Which of the following are proper disinfection steps? Check all the O Remove organic matter O…

A: Introduction: Disinfection is substances that are applied to non-living objects to destroy…

Q: Given ohationg im which is a Jlist of orgamelles ņ mitochondira, endopla smic rediculerm,pesoxisomes…

A: A cell is composed of a cell membrane, cytoplasm, and cellular organelles in the cytoplasm.…

Q: A mixture of Alanine (pl 6.02), Glutamic Acid (pl 3.22), Glycine (pl 5.79), Lysine (pl 9.74) and…

A: Ion exchange chromatography is used to separate molecules based on their net surface charge.

Q: Only one of the statements below is correct; which one? Two solutions are hypotonic when they have…

A: Tonicity is a parameter of the effective osmotic pressure gradient, which is the difference in water…

Q: Draw two diagrams, one showing what enzymes and products are produced when GLN is high and one when…

A: Gln in question stand for Glutamine. Glutamine is an amino-acid exist in L-form like other amino…

Q: Increased levels of NADH in the liver promote the process of gluconeogenesis. What do you make of…

A: Introduction: The process of synthesis of glucose or glycogen from non-carbohydrate sources in the…

Q: The fact that some eukaryotic rRNAs are self-splicing indicates that (A RNA can contain modified…

A: When transcription of DNA to RNA happens the introns are removed either by the RNA itself or by a…

Q: Unsaturated fatty acids are commonly esterified at the hydroxyl substituent of glycerol at what…

A: Glycerol : It has 3 hydroxyl groups that get esterified with 1,2 or 3 fatty acids giving…

Q: Choose the wrong statement: Select one: O a. Energy can be converted from one form to another. O b.…

A: ATP (adenosine triphosphate) is a molecule that provides energy to drive many processes in the cell,…

Q: Question 12 C17H29COOH O linolenic acid O non-saponifiable O w-3 fatty acid O All are correct

A: C17H29COOH - It has double bonds at 9, 12, 15th carbon position

Q: How many molecules of NADH are produced if 12 molecules of glucose enter the glycolytic pathway?

A: Glycolysis is a catabolic process which occurs in cytosol.

Q: Only one of the statements below is correct; which one? Two solutions are hypotonic when they have…

A: Here, four statements are given based on osmotic pressure and we have to find out the correct…

Q: All are factors or subunits contained within the E. coli RNA polymerase holoenzyme in prokaryotic…

A: Transcription is the process of synthesizing RNA from genetic information stored in DNA. There are…

Q: ng glycolysis, t

A: Disclaimer: “Since you have asked multiple question, we will solve the first question for you. If…

Q: Only one of the statements below is correct; which one? O Two solutions are hypotonic when they have…

A: Tonicity is a parameter of the effective osmotic pressure gradient, which is the difference in water…

Q: Why in infants idiopathic hypercalcemia occurs?

A: Hypercalcemia is a condition in which there occurs excess calcium in the serum of affected person.…

Q: 7. What is the base sequence, specified in the 5' to 3' direction, for a segment of newly formed DNA…

A: The genetic material in most organism is double stranded DNA with the two strands running in…

Q: THE TADLE DY REFERRING T OTHE STEP Name of Reaction Reactant Enzyme Product Phosphorylation Glucose…

A: Glycolysis is the catabolic pathway in which Glucose is broken down into 2 molecules of 3C…

Q: Calculate the values of the

A: Enzyme kinetics is a study of the rate of enzyme catalyzed reactions. In Michaelis-Menten kinetics,…

Q: 1. A farmer crossed a round-shaped (T) and yellow-colored (Y) seed plant carrying yellow seeds (Y)…

A: Dominant allele of a gene expresses phenotype even if it present in single copy. So dominant…

Q: What are the general characteristics of the primary, secondary, tertiary, and quaternary structure…

A: Proteins are unbranched polymers constructed from 22 standard amino acid. They have four levels of…