Rank the following DNA changes in order from least likely to change a phenotype to most likely to change a phenotype. Explain your ranking. A. A C → T change in an exon that results in an amino acid change in the resulting protein from alanine to valine (a conservative change) B. A C → T change in an exon that does not result in an amino acid change but introduces a new splice site C. A 2 bp insertion in the 3rd to last codon of a gene D. An expansion of a CGG repeat in the promoter of a gene from 50 copies to 200 copies E. A duplication of an entire gene

Rank the following DNA changes in order from least likely to change a phenotype to most likely to change a phenotype. Explain your ranking. A. A C → T change in an exon that results in an amino acid change in the resulting protein from alanine to valine (a conservative change) B. A C → T change in an exon that does not result in an amino acid change but introduces a new splice site C. A 2 bp insertion in the 3rd to last codon of a gene D. An expansion of a CGG repeat in the promoter of a gene from 50 copies to 200 copies E. A duplication of an entire gene

Name: Rank the following DNA changes in order from least likely to change a
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Rank the following DNA changes in order from least likely to change a phenotype to most likely to change a phenotype. Explain your ranking. A. A C → T change in an exon that results in an amino acid change in the resulting protein from alanine to

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 12TYU

See similar textbooks

Similar questions

Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)
Complete the table below 6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G A C T GA C G A T C-5’. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence, then transcribe (indicating 5’ and 3’ ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each?6.a. Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.b. Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of…
A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A:This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B:This will not affect the phenotype because only the second amino acid is different from the original protein. C:This will not affect the phenotype because the protein will be identical to the original protein. D:This will affect the phenotvpe because all of the amino acids after the first one will be different from he original protein.
a. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? b. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? c. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence? d. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?
Which type of mutation would expect would have no effect on a protein coding gene in eukaryotes? a.a single base substitution that creates a splice site mutation b.a single base substitution that creates a synonymous mutation c.a single base deletion that creates a frameshift near the 3' end of the open reading frame d.a single base substitution that creates a non-conservative missense mutation e.a single base substitution that creates a conservative missense mutation
Refer to a genetic code table for the question. below is a portion of the template strand of a particular gene sequence. Which of the following would be the correct sequence of amino acids in the protein that this portion of the gene encodes? (Note that there are no entrance in this gene sequence, and this portion is found in the middle of the coding sequence, past the start codon, so you should transcribe and translate the entire portion of this sequence) template DNA : 3' - ACG GGT TCC TTT AAC GCG TAG -5' A) Thr-Gly-Ser-Phe-Asn-Ala B) Cys-Pro-Arg-Lys-Leu-Arg-Ile C) there is not enough information given to determine the amino acid sequence of this portion of the gene .
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
Consider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. The nucleotides are numbered 1 to 100. a)Although the transcription start site begins at the underlined C/G, which of the following is the nucleotide sequences needed upstream for transcription to actually occur? b)What are the first 15 nucleotides of the mRNA? c)What are the first 5 amino acids translated from the resulting mRNA? d)A different mutation results in the substitution of the T/A base pair at position 30 (shown in bold and underlined) with a G/C base pair. How would this mutation affect the sequence of the protein that is produced?
Would a gain of function mutaion that occurs in the first exon of a gene with twelve exons more likely be missense or nonsense? Briefly explain your choice. List one disease that we studied in class that is due to a gain of function.