Read the statements below and choose the one statement that is true regarding DNA methylation. DNA methylation negates or neutralizes the positive charges on histones In comparing a liver cell and a brain cell of one individual, you would expect DNA methylation patterns to be different DNA methylation is an example of post transcriptional gene regulation You would expect the gene for fetal hemoglobin to be closed and unmethylated in an adult red blood cell DNA methylation maintenance is dependent on 3' CpG 5' palindromic sequences

Read the statements below and choose the one statement that is true regarding DNA methylation. DNA methylation negates or neutralizes the positive charges on histones In comparing a liver cell and a brain cell of one individual, you would expect DNA methylation patterns to be different DNA methylation is an example of post transcriptional gene regulation You would expect the gene for fetal hemoglobin to be closed and unmethylated in an adult red blood cell DNA methylation maintenance is dependent on 3' CpG 5' palindromic sequences

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 4DID

See similar textbooks

Similar questions

Duchenne Muscular Dystrophy (DMD) is a disease that manifests in muscle weakness. It exhibits X-linked recessive inheritance pattern. The dystrophin gene is large and can have many different mutations along the DNA. From the following mutations between the gene sequence (DNA template strand) of a healthy male and an affected brother determine if they would affect the production of mRNA or the sequence of the protein. Base your analysis on the position of the mutation in the transcription unit, and the impact of the change on the codons. Mutation 1: Position -6 Healthy individual A Affected brother C Group of answer choices A. Normal mRNA, normal protein B. No mRNA produced (promoter affected) C. Abnormal mRNA, affected protein D. Normal mRNA, affected protein Base your analysis on the position of the mutation in the transcription unit, and the impact of the change on the codons.
How do dietary factors interact with DNA methyltransferase to affect an organism's phenotype in an epigenetic manner? Some dietary factors degrade DNA methyltransferase, preventing it from removing methyl groups from sections of DNA, thereby altering gene expression Some dietary factors interact with methyl groups directly preventing DNA methyltransferase from methylating any DNA, changing gene expression in the organism as a result Some dietary factors inhibit DNA methyltransferaseactivity, reducing the methylation of the organism's DNA and changing its gene expression Some dietary factors bind toDNA methyltransferaseand enable it to methylateDNA, thereby changing geneexpression Some dietary factors upregulate DNA methyltransferase activity, increasing the overall methylationof the organism's DNA and changing its gene expression
Which of the following is NOT true of DNA Methylation. A. DNA methylation is typically correlated to gene repression. B. On a given gene, histone modifications or DNA methylation could be used, but not both at the same gene. C. DNA methylation can be used in mismatch repair to identify the parent strand after DNA replication. D. DNA methylation typically occurs on dCTP nucleotides in eukaryotes. E. DNA methylation can be inherited through mitosis.
What would happen in the directionality of that activity were reversed? Would proofreading work? If the genomic DNA polymerase were missing its proofreading function (deletion in the domain or subunit), what phenotype would you expect to see in those cells? Please give me the correct answer quickly I will give you upvote
Which of the following statements uses the term homologous correctly?A. The two X chromosomes in female mammalian cells are homologousto each other.B. The α-tubulin gene in Saccharomyces cerevisiae is homologousto the α-tubulin gene in Arabidopsis thaliana.C. The promoter of the lac operon is homologous to the promoterof the trp operon.D. The lacY genes of E. coli and K. pneumoniae are approximately60% homologous to each other.
Cap, EA1, and Sap are all genes/proteins of interest in this study. For each gene, what gene product is encoded and where is the gene (the literal DNA sequence) located physically in the cell? I need help fimiding this in the artticle and answer as short as possible https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/
Researchers studying the Dutch famine of the winter of 1944-45 found that effects of malnutrition during pregnancy were still seen two generations later, for example in rates of obesity. How could this environmental effect be inherited over generations? Choose the most likely answer A. The results were an artefact, because environmental conditions were not taken into account. B. Histone modifications such as acetylation are passed on through generations. C. All methylation patterns are scrubbed during development of an embryo. D. DNA methylation patterns can be passed on in a parent-of-origin specific manner.
What is the role of DNA methylation in eukaryotes? To protect the DNA from restriction endonucleases To prevent nucleosome formation on that region of DNA To distinguish the active X chromosome from the inactive X chromosome in counting To aid in silencing transcription DNA methylation does not occur in eukaryotes, only histones are methylated.
Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please select all the peptide sequence(s) that could be produced from the mRNA transcribed from this segment of DNA. (Hint: you need to use the genetic codon table to translate the determined mRNA sequence into peptide. Please be reminded that there are more than one reading frames.) Question 6 options: ...-Asp-Cys-Gln-Ser-... ...-Leu-Thr-Val-... ...-Thr-Val-Ser-... ...-Leu-Ser-Val-... ...-Met-Asp-Cys-Gln-...
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
Which of the following mutations could be appropriately describedas a position effect?A. A point mutation at the –10 position in the promoter regionprevents transcription. B. A translocation places the coding sequence for a muscle-specificgene next to an enhancer that is turned on in nerve cells.C. An inversion flips a gene from the long arm of chromosome 17(which is euchromatic) to the short arm (which isheterochromatic).
Scientists have observed that individuals with LOW birthweight are MORE likely to become obese as teenagers. To study this observation in more depth, a scientist compared the methylation of the promoter region of the leptin gene in low birthweight (LBW) and normal birthweight (NBW) individuals by treating isolated DNA from these individuals with bisulfite and comparing the results to untreated DNA. The results are shown below. What conclusion can you draw? Untreated: ATTCGATTCGCGAA Treated NBW: ATTCGATTCGCGAA Treated LBW: ATTTGATTCGTGAA Scientists have observed that individuals with LOW birthweight are MORE likely to become obese as teenagers. To study this observation in more depth, a scientist compared the methylation of the promoter region of the leptin gene in low birthweight (LBW) and normal birthweight (NBW) individuals by treating isolated DNA from these individuals with bisulfite and comparing the results to untreated DNA. The results are shown below. What…