RNA nucleotides can undergo versatile base pairing. What does this mean, and what is the consequence for the structure of RNA?  Please help simplify/explain this in 5 sentences or less

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′Make a drawing.

A: RNA stands for ribonucleic acid. It is a complex compound comprising of high molecular weight and…

Q: true or false The structure of the transfer RNA assumes a more 3-dimensional structure because of…

A: Structure of tRNA: It consists of 4 parts: Acceptor stem: It attaches the AA Anticodon loop: It…

Q: C4GUCAGUCAGUCO/ Use the codon chart to determine the following RNA strand in amino acids (Remember…

A: Genetic code The relationship between the sequence of amino acids in a polypeptide chain and…

Q: Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the…

A: Each codon is made up of three nucleotides, each of which corresponds to a single amino acid. The…

Q: threonine, alanine, and isoleucine. The TRNA anticodons for the amino acid sequence shown above is…

A: Protein synthesis or translation process takes place on the ribosomes with the help of messenger RNA…

Q: TRUE OR FALSE a) Primary amines and keto groups of the nitrogen bases are involved in base-pairing…

A: Primary amines are amines whose nitrogen atom is bound only to a single carbon atom. In secondary…

Q: Order of bases in DNA Order of bases in MRNA (codon) AUC Order of bases in tRNA TAG Amino acid coded…

A: Amino acids are the smallest monomers which are known to form the polypeptide sequence of the…

Q: The Shine-Dalgarno Sequence is used in bacteria eukaryotes both

A: The nucleotide segment at the 3' terminal of 16S ribosomal RNA (rRNA) has several pyrimidines with a…

Q: RNA forms a double helical structure

A: RNA is a polymer of ribonucleotides held together by 3',5'-phosphodiester bridges. There are certain…

Q: Is RNA-binding enzyme RNase A more likely to have a pI of 9.2 or 5.0?Briefly explain your reasoning.

A: Ribonuclease A (RNase A) is a digestive enzyme secreted by the pancreas that specifically digests or…

Q: In RNA, an atypical base pair is able to form between guanine and uracil. This base pair allows a…

A: Introduction A Base Pair Is Made Up Of Two Chemical Bases That Are Bound Together To Form A "rung Of…

Q: The following are all true of RNA, excepta. it is a single-stranded molecule existing in helical…

A: Friedrich Meischer discovered nucleic acids from the nuclei of pus cells and coined the term…

Q: If you have a given amino acid, can you be able to identify its RNA? Why or why not?

A: The protein is made up of amino acids and it is the final product of a gene. It determine the…

Q: When nitrogenous bases in single-stranded polynucleotides are incorporated into doublestranded…

A: DNA and RNA both absorb maximum light of 260 nm wavelength. 260 nm light comes in the ultraviolet…

Q: The Watson-Crick double helix is: O a. a. primary structure O b. tertiary structure O c. quaternary…

A: Nucleic acids are considered biomolecules that are very long threads of polymers. It is made up of a…

Q: Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand…

A: A gene mutation that results from the substitution of one base pair of another. TATGAAAGT non…

Q: In the early days of molecular biology, some researchers speculated that RNA, but not DNA, might…

A: Molecular biology is the field of biology that studies the composition, structure, and interactions…

Q: Please by using the first base of each as the first triplet in a condo, how do I translate two…

A: Translation Translation is the process in which the mRNA or messenger RNA is get translated. mRNA of…

Q: Adenine and guanine are examples of the_________________________ class of nitrogenous bases.

A: Introduction: The nitrogen bases act as the building blocks of the nucleic acids, deoxyribonucleic…

Q: What base is found in RNA

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Why does RNA use uracil instead of thymine?

A: Deoxyribonucleic acid or DNA can be defined as a molecule is a double helical structure that carry…

Q: Which one of these indicated groups or bonds: hydroxyl; phosphate; triphosphate; nitrogen base;…

A: DNA carries genetic information. DNA is a double-stranded molecule. The strands of DNA double-helix…

Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…

A: Introduction  The process by which the genome's DNA is copied in cells is known as DNA replication.…

Q: Given the following sequence for an RNA molecule, find a second- ary structure that will be…

A: RNA or ribonucleic acid is a chain of ribonucleotides. Ribonucleotides are made uo of three units:…

Q: An RNA molecule has the following percentages of bases: A = 23%, U = 42%, C = 21%, and G = 14%. Q.…

A: RNA stands for ribonucleic acid which acts as a messenger in carrying instructions from DNA for…

Q: Find self-complementary regions in the following RNA sequence: AUGUGGCAUGCCAGG

A: Biomolecules includes carbohydrates, lipids, nucleic acids and proteins. Nucleic acid plays an…

Q: Discuss the structural significance of complementarity in DNAand in RNA.

A: Complementarity Complimentarity achived by interaction between these nitrogenous bases. DNA is…

Q: what is the significance of secondary structure of RNA by folding upon itself

A: DNA has double stranded structure in which the two strands are anti parallel to each other and base…

Q: Why is RNA so unstable?

A: The cells are the basic structural and fundamental blocks of the living system. it consists of…

Q: The enzyme thiouridylase converts certain tRNA uridine residues to 2-thiouridine. Draw the structure…

A: Enzyme is a catalytic molecule that increases the rate of any chemical reaction without being used…

Q: When cytosine is treated with bisulfite, the amino group is replaced with a carbonyl group. Identify…

A: Studies on the interactions between chemicals and nucleic acids are important because they can be…

Q: For the RNA sequence AUUGGCAUCCGAUAA, draw the secondary structure that maximizes its base pairing.

A: RNA molecules usually come as single strands but when left in the environment, they fold themselves…

Q: The sequence of a polypeptide is determined by the order of codons that specify the amino acids in…

A: Proteins are the ultimate products of the genes. DNA is transcribed into m RNA and this is…

Q: nbonucleotide in automated RNA synthesis. Point to the functional groups

A: In automated RNA synthesis, a ribo nucleotide is used. When we look at epinephrine signalling, we…

Q: Most RNA molecules have three phosphate groups at the 5′ end, but DNA molecules never do. Explain…

A: The first nucleotide of the RNA is triphosphate because the triphosphate is not cleaved at the first…

Q: . Some naturally occurring polynucleotide sequences are palindromic; that is, they are…

A: The palindromic sequence is the DNA or RNA sequence that has the same sequence in complementary…

Q: how many letters of rna molecules in squence does it take to provide the code for a single amino…

A: RNA is involved in the synthesis of protein and this is carried out through a process called…

Q: Which base compositions for single-stranded RNA are possible? %A %G %C %T %U OA. All of the answers…

A: RNA are single stranded, their nucleobases donot participate in base pairing. According to the…

Q: Why is RNA structure so unstable? Explain in detail.

A: RNA is generally single stranded. RNA is a polymer of nucleotides. Nucleotides of RNA are composed…

Q: Which of the following bases are found in RNA choose all that apply

A: RNA is composed of four nitrogenous bases: adenine, cytosine, uracil, and guanine. Uracil and…

Q: The nucleoside inosine frequently occurs as the third base in codons. What role does inosine play in…

A: Inosine is the nucleoside made up of ribose and hypoxanthine.

Q: Identify the nitrogenous base that is not typically found in an RNA molecule. cytosine thymine…

A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…

Q: Which of the following are essential characteristics of RNA? (Not characteristics that are typical,…

A: Presence of uracil defines a nucleic acid structure to be an RNA. Being single stranded is not a…

Q: On your scrap paper, please drawa RNA secondary structure that has the following structures (1) Two…

A: Secondary structures are comprised of several types of elements, or “building blocks”. Each element…

Q: Name the bases present in RNA. Which one of these is not present in DNA?

A: KEY WORDS :- RNA - Ribonucleic acid DNA - Deoxyribonucleic acid

Q: Write an RNA structure having 8 nucleotides.

A: RiboNucleic Acid (RNA) is the polymer of nucleic acids in 5' to 3' direction. RNA is a single strand…

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.