Q: For each, choose either replication, transcription, or translation. Okazaki fragment [ [ Choose ]…
A: The three main processes of central dogma of molecular biology are replication, transcription, and…
Q: Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA…
A: Transcription is a process of formation of transcript or RNA from DNA by the process of…
Q: The base sequence on one strand of DNA is ATGTCTATA(i) Give the base sequence of its complementary…
A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…
Q: The template strand (notice the directionality) of DNA that is known to encode the N-terminal region…
A: The biochemical material that is transferred from the preceding generation to the succeeding…
Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…
A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…
Q: Translation always begins by adding a methionine to the beginning of every
A:
Q: Coding strand of DNA, complimentary to the template strand 5' 3' A T G C T T G CA CATT G a GA A G A…
A: A molecule made up of two chains of a polynucleotide that generate a double helix by coiling around…
Q: 5'AGGCTCCAGG 3' Which complementary RNA strand can be made from this sequence? Select one: O a. 5'…
A: formation of m RNA from DNA is called transcription. RNA polymerase synthesizes m RNA by adding…
Q: Draw the structure of a dinucleotide formed by joining the 3 '-OH group of dTMP to the 5 '-phosphate…
A: A dinucleotide is a compound of nucleic acid which was composed of two nucleotides. each nucleotide…
Q: What does rna, polymer
A: (Please note- Only half of your question is clear, so below we have answered- What does rna, polymer…
Q: enzymes will form the m-RNA molecule?
A: The correct answer is option d). RNA polimerases II
Q: Given the following sequence for one strand of a double-stranded oligonucleotide:…
A: Nucleic acids are of two types: RNA and DNA RNA It is referred to as ribonucleic acid. It is…
Q: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you…
A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: What is the nucleotide sequence of the complementary strand of the DNA molecule:…
A: Nucleic acids are large macromolecules that store hereditary information for cellular growth and…
Q: THCA 100 This reaction is Entropy is THC ( Leafly Mur AD RNA polymerase ATGACGOATCAGCCOCAAG…
A: Tetrahydrocannabinol Acid when heated converts into delta-9-tetrahydrocannabinol. the reaction is…
Q: An RNA molecule has the following percentages of bases: A = 27%, U = 38%, C=20%, G= 15%. (A) Is this…
A: DNA is composed of nucleotide. In nuclear tide there is one ribose sugar, one phosphate molecule…
Q: A tRNA is charged with the amino acid methionine.(i) Give the anti-codon of this tRNA.(ii) Write the…
A: Transfer RNAs (tRNAs) are the adaptor RNA molecules that serve to carry the amino acids from the…
Q: RNA- degrading enzyme.
A: RNA is ribonucleic acid. It is single stranded. It has four bases adenine, guanine, cytosine and…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: b) the sequence of the…
A: The given DNA sequence is as follows 3’–CGATACGGCTATGCCGGCATT–5' The above given strand is a…
Q: Which one of these indicated groups or bonds: hydroxyl; phosphate; triphosphate; nitrogen base;…
A: DNA carries genetic information. DNA is a double-stranded molecule. The strands of DNA double-helix…
Q: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you…
A: Answer a. The sequence of the strand of DNA it would be paired within a double-stranded helix is…
Q: A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA -…
A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…
Q: Complete the table below: DNA DNA Complimentary Strand mRNA sequence tRNA sequence Amino…
A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…
Q: The following diagram represents one of the Christmas-tree-like structures shown in Figure On the…
A: The Christmas tree-like structure is observed under an electron microscope of the DNA undergoing…
Q: how do you translate this sequence RNA A C U G U C A U G A G C C C U G C A…
A: Translation is the process by which proteins are synthesized by the ribosomes after the process of…
Q: Which structure is responsible for translating MRNA? O a. RNA Polymerase II O b. RNA polymerase I O…
A: Introduction Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that corresponds to…
Q: Which strand was used for the following old amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…
A: By the process of transcription mRNA is produced from the DNA. the transcription process occurs…
Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…
A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…
Q: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ a.Complementary Strand: b. Direct Transcript: c. Transcript for…
A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…
Q: The two large subunits of the E. coli RNA polymerase are called B and B' are related to the large…
A: Ribosomes are tiny particles made up of RNA and associated proteins that are responsible for protein…
Q: why is it nessecary to modify the RNA molecule?
A: RNA molecules are highly interesting molecules, which perform a variety of functions and helps in…
Q: nbonucleotide in automated RNA synthesis. Point to the functional groups
A: In automated RNA synthesis, a ribo nucleotide is used. When we look at epinephrine signalling, we…
Q: Fill in the blank with the most appropriate term that is described by the following statement:…
A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…
Q: How many components are there in RNA polymerase of prokaryotes? List down the functions of each…
A: RNA polymerase is an enzyme responsible for the synthesis of RNA using the DNA as a template through…
Q: RNA polymerase will attach with what sequence(s) and begin to make RNA? Anticodon Promotor stop…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Which of the following is/are required for RNA synthesis? (sel
A: RNA synthesis is made from the DNA molecule. so RNA synthesis is the synthesis of RNA like mRNA from…
Q: Draw a picture showing the sticky ends that are produced by BamHI digestion (BamHI cuts between the…
A: Enzymes that can cleave the DNA at specific sites are known as restriction enzymes. There are two…
Q: Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence…
A: The deoxyribonucleic acid (DNA) undergoes the process of transcription for synthesizing the…
Q: Figure 1 shows that remdesivir "mimics" an important component of RNA replication. Which component…
A: The SARS-CoV-2 virus causes Coronavirus Disease, often known as COVID-19. COVID-19 causes are mild…
Q: Which protein is NOT necessary to initiate DNA replication in E. coli? A. helicases
A: The biological process of making two identical DNA replicas from a single original DNA molecule is…
Q: A DNA antisense strand contains the following nucleotide base sequence: CGA TTT GGT TGA From this,…
A: INTRODUCTION The RNA polymerase enzyme will read the DNA strand and make the mRNA molecule.
Q: What feature of RNA would allow it to function as a ribozyme? Why are there no naturally occurring…
A: An RNA that has enzymatic activity called ribozyme.
Q: Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence:…
A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…
Q: Create the RNA strand to be synthesized from the DNA double strand below and explain this synthesis,…
A: DNA are double helical structures that contains genetic information, which is responsible for almost…
Q: Why does DNA synthesis start with an RNA primer
A: By extending an RNA primer in the 5' to 3' direction, DNA polymerase begins to synthesise a new DNA…
Q: Create the RNA strand to be synthesized from the DNA double strand below and explain this synthesis,…
A: Transcription of DNA into mRNA and translation of mRNA into protein is known as the central dogma of…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.Human ribonucleotide reductase has two allosteric sites, the S site and the A site. What is the function of each? How does this compare with the E. Coli enzyme discussed in the text?Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the same amino acid. What is the amino acid ?
- Explain why the translation of a given mRNA can be inhibited by a segment of its complementary sequence, a so-called antisense RNA.A small section of bacterial enzyme has the amino acid sequence arginine, threonine, alanine, and isoleucine.The tRNA anticodons for the amino acid sequence shown above is a. GCA UGC CGA UAC b. GCC UGA CGU UAG c. CGA AGA GCC AUA d. GCG UGG CCC UAAwhy the Shine–Dalgarno sequence is important to prokaryotes?State the bases of prokayotes’ mRNA