Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand (sense strand) 3' АТАСТТТСА 5' transcribed strand In the space below, write ONE of the possible DNA sequences of the transcribed strand shown above that results from BOTH a single substitution mutation of the first codon following the start codon that would also cause a nonsense mutation. Use the mRNA codon chart in the Appendix of your manual to help you. Answer:

Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand (sense strand) 3' АТАСТТТСА 5' transcribed strand In the space below, write ONE of the possible DNA sequences of the transcribed strand shown above that results from BOTH a single substitution mutation of the first codon following the start codon that would also cause a nonsense mutation. Use the mRNA codon chart in the Appendix of your manual to help you. Answer:

Name: Consider the following wild-type double-stranded DNA sequence:5' TATG
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Consider the following wild-type double-stranded DNA sequence:5' TATGAA AGT3non-transcribed strand (sense strand)5'3' ATACTTTCAtranscribed strandIn the space below, write ONE of the possible DNA sequences of the transcribedstrand shown above that re

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. Use the table and write the sequence of the resulting peptide. Is it possible for a codon to code for another amino acid? What will be the effect if a mutation changes the codon UAU to UAA? What is a reading frame? If you are given a nucleotide sequence, how would you find Open Reading Frames? DISCUSS the reason why there are leading and lagging strands in replication?
Consider this nucleotide sequence of DNA strand in the image provided. If this strand is the sense strand, Give the correct nucleotide sequence of the RNA produced after transcription. If the RNA formed in #1 is already a functional mRNA and will be used to synthesize proteins, how many codons are present here that will actually code for amino acids? What is the sequence of the stop codon in this mRNA? What is the sequence of the 3rd codon in this mRNA? What is the sequence of the last codon in this mRNA that actually code for an amino acid?
Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. Example: (USE SPACES BETWEEN CODONS): ' XXX XXX XXX XXX ' Example: (USE SPACES BETWEEN AMINOACIDS): Polypeptide: direction-XXX-XXX-XXX-direction ATG GCA TGC AAT AGC TCA TGC b) What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A? (3
The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…