Imagine that a mutation in a DNA molecule results in the codon CCU being changed to CCC. Both of these codons code for proline. The fact that more than one codon can code for the same amino acid is referred to as ___ a. the ambiguity of the genetic code b. the redundancy of the genetic code c. the randomness of the genetic code d. mutations in the genetic code

Q: Sickle cell anemia is a disease caused by a mutation at the genotypic level. A person with two…

A: Sickle cell anemia is an autosomal recessive trait, in which the beta-chain of the hemoglobin gets…

Q: Which of the following is NOT true regarding the genetic code and translation? a) An mRNA is…

A: Deoxyribonucleic acid or DNA is a type of nucleic acid that is present in the nucleus of the cell.…

Q: AAAC G CA G CCG Phe Gly Arg

A: In this image, we are shown the formation of proteins from DNA by following the central dogma of…

Q: The function of the genetic code is toa. promote transcription.b. specify the amino acids within a…

A: Genetics can be defined as the branch of biology which is concerned with the study of genes, genetic…

Q: The function of the genetic code is toa. promote transcription.b. specify the amino acids within a…

A: Genetic code is a set of rules used by living organism’s cells in the process of translation that is…

Q: Sequence of nucleotides in MRNA|AUGCGUUCAUGGACU Sequence of amino acids in protein

A: Sequence of nucleotide in mRNA  AUGCGUUCAUGGACU is given .

Q: Refer to the Table of the Genetic Code and match the type of mutation to the following codon changes

A: Mutation : A mutation is defined as the changes in the nucleotide sequence. These results in…

Q: Evaluate the following statements. Which one statement is false?

A: Answer: Central Dogma : It is the complete process of replication , transcription and translation of…

Q: acid   (b) the genetic code can mutate

A: Introduction : The DNA molecule which is the genetic material, is converted to mRNA by the process…

Q: Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about…

A: Introduction: 20 amino acids make up all the proteins. These are the building blocks of proteins…

Q: Figure out the mutation. You will need the codon table to answer this question. Wild type DNA…

A: DNA is two strand ladder like structure which consists of :-  A ) Coding strand  B ) Template strand…

Q: 44

A: The given structure is of tRNA molecule which is an adapter molecules for amino acid synthesis.

Q: Use the figure to answer the question. 5' tRNAS , which are single-stranded, have what is described…

A: Introduction :-  t-rna (transfer RNA)   which is used in translation i.e protien synthesis.Its…

Q: Which of the following is a function of TRNA? O A) brings one amino acid to the ribosome B)…

A:

Q: Exon shuffling is a proposal that relates exons in DNA to the repositioning of functional domains in…

A:

Q: A nonsense mutation in a gene:   A. introduces a premature stop codon into the mRNA   B.…

A: Any permanent change or alteration occurred in the DNA sequence is termed as the genetic mutation.…

Q: What is the genetic code? a. The relationship between a three-base codon sequence and an amino acid…

A: Translation is the process of conversion of an mRNA (messenger RNA) molecule into a functional…

Q: Which of the following statements about the genetic code are true and which are false? Correct each…

A: Genetic code is the sequence of nucleotides in the mRNA that determines the sequence of amino acids.…

Q: The diagram below shows the result of a hybridization experiment between a eukaryotic mRNA and the…

A: The process of hybridization refers to the combination of two complementary single-stranded RNA or…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: A gene mutation Is defined as change in the Select one: A. nucleotide sequence of DNA. • B.…

A: Mutations are of many types, such as Deletion, insertion, base substitution, and frameshift. There…

Q: Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense…

A: A nonsense mutation is one in which change in nucleotide will result in a stop codon. This will…

Q: A codon is: a. An alternative name for gene b. Three amino acids that encode a nucleotide c. Three…

A: Introduction: Option C. is the correct choice.

Q: Which of the following is a characteristic of the genetic code? a. codons and anticodons consist of…

A: Genetic code is considered as the base triplet code, which poses 3 nucleotide bases. These codons…

Q: Use the table to answer:   A portion of an mRNA attached to a ribosome reads: 5′…

A: Ribosomes (macromolecular structure) composed of rRNA and polypeptide chains are formed of two…

Q: Define the following terms: a. wobble hypothesis b. aminoacyl-tRNA synthetase c. tRNA d. AUG…

A: Wobble hypothesis was proposed by scientist Crick mainly to explain the observed degeneracy in the…

Q: Use your genetic code (codon) table to answer the next two questions: What type of mutation would…

A: The answer to the above question is given below.

Q: The tRNA for Phe binds to the mRNA codon UUU. You mutate the anticodon of the Phe-tRNA from AAA to…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: The anticodon of a particular tRNA molecule is(A) complementary to the corresponding mRNA codon.(B)…

A: The heart of protein synthesis is the translation of nucleotide sequence information in the form of…

Q: A missense mutation is a mutation in which: a. one nucleotide in a codon is changed, but the codon…

A:

Q: Rank the following DNA changes in order from least likely to change a phenotype to most likely to…

A: Conservative replacement is an amino acid is exchanged into another that has similar properties and…

Q: Give two examples of places you could have mutations in the DNA sequence of a eukaryotic gene that…

A: The change in the heritable characteristics of the species across many generations is called…

Q: Sickle cell anemia is a disease caused by a mutation at the genotypic level. A person with two…

A: sickel cell anemia is a type of anemia in which the red blood cells are abnormally shaped and…

Q: Each combinations of nitrogen bases on the mRNA molecule is a codon, which is a three letter code…

A: 4) tryptophan- UGG 5) Leucine- CUU, CUC, CUA, CUG

Q: Which of the following is an example of the degeneracy of the genetic code? Group of answer choices…

A: Answer of the question given below...

Q: The codon on the ________ matches with the anticodon on the ________ to direct the addition of the…

A: Codon are the triple of a base pair.

Q: Which of the following is not true of a codon?(A) It may code for the same amino acid as another…

A: The genetic code involves the set of rules determining the conversion of nucleotide sequence into a…

Q: Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: a mutation occurred in the g of the codon below and the G became a C   A  T  G Changes to A  T  C…

Q: The genetic code is said to be degenerate, which means that: A An anticodon can interact with more…

A: There are only 20 essential amino acids that needs to be synthesized during formation of a…

Q: Which mutation changes a normal codon to another codon specifying the same amino acid a. directed b.…

A: Any change in the base pair of the sequence of base pairs that are present in the nucleic acid…

Q: Below is a short segment of a DNA molecule. Transcribed the DNA codon into mRNA. Use your data sheet…

A: Transcription is the process by which RNA polymerase read out DNA template stand and synthesize…

Q: Which mutation changes a normal codon to another codon specifying the same amino acid a. directed b.…

A: In missense mutation codon for an amino acid gets replaced. Then option b is wrong.

Q: Now imagine that a mutation occurred in the second T of the codon below and the T became a G. How…

A: A mutation occurs when there is a change in the nucleic acid sequence. These mutations could be…

Q: Which of these features is found in eukaryotes but not bacteria?a. polygene mRNAs b. introns c. stop…

A: Living organisms are primarily classified as prokaryotes and eukaryotes. Prokaryotic organisms like…

Q: The role of transfer RNA (tRNA) is to match a codon (3 bases) in mRNA sequence to:   A. An amino…

A: The process of protein synthesis is also known as translation. It is possible with the help of…

Q: Which of these is the function of a poly (A) signal sequence? A. It adds the poly (A) tail to the 3'…

A: In the yeast the poly (A) signal sequences are present which are short sequences and redundant in…

Q: The information in DNA is used by cells to produce proteins that perform various functions in cells.…

A: Transcription is the formation of a sequence of RNA using DNA as a template and DNA dependent RNA…

Q: Use your genetic code (codon) table to answer this question: A tRNA has the anticodon GCU. Which…

A: The anticodon of any one tRNA fits impeccably into the mRNA codon that codes for the amino corrosive…

Q: d. Which amino acid is represented by (6)? e. Give the one anticodon in the 5' to 3' direction that…

A: In this question, we are shown the process of protein formation from a DNA sequence. This takes…

Q: The codons in the genetic code are sequences of three bases. Explain why sequences of only two bases…

A: In general it is explained that DNA is comprised of 4 different nucleotides (A, C, T, and G),…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.