What would be the tRNA anticodons for the mRNA in question 3

Q: If a tRNA has an anticodon sequence 3′–CCI–5′, what codon(s) can it recognize?

A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles. It includes…

Q: The anticodon of a tRNA is 5' AAU 3' a. What codon does the tRNA recognize? b. What amino acid does…

A: BASIC INFORMATION  TRANSLATION  It is the process through which the proteins are made with the…

Q: AGGTATCGCAT is a sequence from the coding strand of a gene. What will bw the corresponding sequence…

A: The terms used in the question represents the molecules used during a gene expression. A gene is a…

Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…

A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…

Q: What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to…

A: Peptides are present in all individuals which are living. Peptides play may functional roles in our…

Q: The codons UGA, UAA, and UAG do not code for amino acids. What is their role as codons in mRNA?

A: Amino acids are the basic structural units or building blocks of proteins. Amino acids are used for…

Q: Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the…

A: During Protein synthesis or translation  that occurs in ribosomes, messenger RNA code for an amino…

Q: What is the difference between a charged tRNA and an uncharged tRNA?

A: Answer: Introduction: Transfer RNA (tRNA) is the type of RNA, consist of a small RNA molecule which…

Q: What mRNA is most obviously essential in coding proteins, list and describe two classes of…

A: RNA is an intermediate between DNA and proteins.

Q: Why can’t the exact sequence of mRNA be determined from a protein’s primary structure? thanks

A: Primary structure of protein  Primary structure of protein is comprise of linear amino acid sequence…

Q: what is c-abl mRNA

A: An mRNA is the RNA encoded from a stretch of DNA template strand to serve as a template for the…

Q: If a tRNA has an anticodon with the sequence 5′-CAG-3′, which amino acid does it carry? a. Aspartic…

A: An anticodon is the nitrogen base triplet present in the transfer RNA molecule and the codon is the…

Q: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

A: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

Q: the sequences od tRNA and corresponding mRNA  is complementary to each other. is the statement true…

A: The synthesis of a functional protein involves two processes namely transcription and translation.…

Q: Define messenger ribonucleic acid (mRNA)

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Q: Given a sequence of a DNA coding strand:     5’-ATGATTATCCTATAG-3’ What is the sequence and…

A: The synthesis of m RNA from DNA is called transcription.

Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…

A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…

Q: If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA?

A: Codon is defined as the the group of three nucleotides that encode an amino acid.

Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…

A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.

Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…

A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…

Q: An anticodon on a TRNA has the sequence 3' UAC 5. What amino acid would it be charged with?

A: The tRNA is the transfer ribonucleic acid and it helps to decode the information present in the mRNA…

Q: An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start…

A: RNA (Ribo Nucleic Acid) is the genetic material found in prokaryotes and eukaryotes. It is the prime…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: From this overall anticodon sequence in tRNA,…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: For the mRNA strand above, use the codons and the diagram below to determine what amino acids will…

A: mRNA sequence: UAC AUG GCC UUA CGC UAA tRNA sequence :  AUG UAC CGG AAU GCG AUU

Q: Give the anti-codon of this Trna?

A: Transfer RNA or tRNA is an adapter molecule, which plays an essential role in decoding the sequence…

Q: You are studying with a friend who says that the hydrogen-bonded portions of tRNA play no important…

A: tRNA is a short nucleotide RNA chain with L-shaped structure. A tRNA molecule is required for…

Q: The amino acid sequence for a short peptide is Tyr-Leu-Thr-Ala. What are the possible base sequences…

A: Gene expression is the process by which information from a gene is used for synthesizing of a…

Q: ) Identify the current stage of the translation process shown in Figure 1 and name the anticodon…

A: Translation is a orocess in which mRNA produce  protein by the help of ribosome and tRNA.there are…

Q: Describe the structure of a polysome, which is depicted.

A: Ribonucleic acid (RNA) is a genetic material that plays a vital role in ribosome and protein…

Q: How many RNA bases are Explain your answer. required to code for a protein that contains 250 amino…

A: Transcription is the process in which one stranded mRNA is synthesized from two stranded DNA…

Q: If a mutation changed the start codon into a stop codon, would this mutation affect the length of…

A: Mutations are the changes in the base sequences of the nucleotides in a gene. They are known as gene…

Q: Write the codons for the following amino acids. 1. Phe 2. Val

A: Genetic codon: - It is the 3 nucleotide sequence of DNA and RNA, all bases are involved in formation…

Q: Determine which amino acid is formed from the following mRNA codon: GUA.     a aspartic acid b…

A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: If a TRNA anticodon was GUG, which amino acid would the tRNA carry? Below is a partial genetic code…

A: TRANSLATION It is the process of formation of a polypeptide chain by joining of various amino acids.…

Q: We have a eukaryotic full-length mRNA molecule consisting of 33 bp 5ʹ -...…

A: The mRNA (messenger ribonucleic acid) is a messenger molecule produced through the process of…

Q: In eukaryotic mRNA there are 90 nucleotide involved in translation process. What is the number of…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: Can a tRNA exist that has the anticodonsequence 5′ IAA? If so, which amino acidwould it carry?

A: Transfer RNAs (tRNAs) are essential in protein synthesis and elongation. The sequence on the mRNA…

Q: Codon to be read in the mRNA is 5' GAA 3', what is the amino acid?  a. E b. K c.F d.L

A: Dear student answer of your question is given below:  Given codon in the mRNA is 5' GAA 3' ,  It…

Q: which level of structure describes  non watson crick intercations in trna

A: According to Watson and crick, the DNA is a nucleotide, it is made up of sugar, nitrogenous base,…

Q: You sequence a new tRNA and discover that the anticodon sequence is 5'-IGC-3. What amino acid does…

A: I corresponds to an unusual bas hypoxanthine, which is found in tRNA

Q: Which of the following are elongation factors involved in the release of free tRNAs? a.EF-G…

A: The above mentioned elongation factors are involved in the process of translation in prokaryotes.…

Q: if mRNA has a codon sequence of 5'-UAG-3', it will encode: Ieucine, no amino acide, methionine, a…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum create…

Q: The relaxation of base-paring rules between the TRNA and mRNA is termed as Answer:

A: Introduction: Ribonucleic acid or RNA is the type of nucleic acid that is mainly present in the…

Q: NA has an anticodon sequence 3′– GGU–5′. Identify the amino acid it is carrying?

A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that takes role in the creation of…

Q: Given the mRNA for a protein: 5'–CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid sequence…

A: DNA is the genetic material that gets transcribed into mRNA by an RNA polymerase enzyme. The…

Q: Using the genetic code table, find the sequence of amino acids coded by the 2 DNA sequences (documi…

A: Transcription is the process by which the genetic information in the DNA segment is copied into an…

Q: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino acid…

A: mRNA(messenger RNA) carries the genetic information copied from DNA in the form of a series of…

Q: In the tertiary structure of tRNA, where is the anticodon region relative to the attachment site for…

A: tRNA is the transfer RNA and an adapter molecule made up of RNA serving as the physical link between…

Q: If a tRNA molecule carries a glutamic acid, what are the two possible anticodon sequences that it…

A: An anticodon is a trinucleotide sequence that is complementary to that of a corresponding codon in…