Sickle cell disease (SCD) is a group of inherited disorders. People with SCD have sickle-shaped red blood cells. A single base substitution mutation can cause one type of SCD. This mutation causes a change in the structure of the beta polypeptide chains in haemoglobin. Explain how a single base substitution causes a change in the structure of this polypeptide.

Sickle cell disease (SCD) is a group of inherited disorders. People with SCD have sickle-shaped red blood cells. A single base substitution mutation can cause one type of SCD. This mutation causes a change in the structure of the beta polypeptide chains in haemoglobin. Explain how a single base substitution causes a change in the structure of this polypeptide.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Similar questions

If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
One of your patients, a six-year-old girl who suffers from Sickle cell anemia, an inherited blood disorder in which red blood cells are abnormally shaped and fragile, leading to a short supply of red blood cells. These abnormal cells can also get stuck in small vessels, which prevent blood flow, leading to fatigue, pain and other severe complications. What is the name of the process in which each peptide is actually assembled, and where does this process take place? transcription, on ribosomes translation, in the nucleus translation, on ribosomes transcription, in the nucleus
if mRNA has a codon sequence of 5'-UAG-3', it will encode: Ieucine, no amino acide, methionine, a mutation, or an anticodon?
What happens when one base pair of DNA is lost from the coding region of a gene because of mutation? First explain how this would affect the mRNA sequence, and second, explain how this would alter the amino acid of the protein that is encoded.
In 3-4 sentences each Explain the difference between an intron and an exon? Explain what happens when eIF-2 is phosphorylated and when it is not phosphorylated?
A cell has a defective enzyme that attaches the alanine amino acid (Ala), instead of a valine amino acid (Val), to tRNAs with the anticodon CAA. Will any polypeptides in the cell contain valine? Why or why not?
A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to 5’ACGTCATGCGATAGTGCGTAAACTA3’ Describe the effect of this mutation on the protein, and give the name of the type of mutation.
Mutations that introduce stop codons cause a number of genetic diseases. For example, from 2% to 5% of the people who have cystic fibrosis possess a mutation that causes a premature stop codon in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR). This premature stop codon produces a truncated form of CFTRthat is nonfunctional and results in the symptoms of cystic fibrosis . One possible way to treat people with genetic diseases caused by these types of mutations is to trick the ribosome into reading through the stop codon, inserting an amino acid in its place. Although the protein produced may have one altered amino acid, it is more likely to be at least partly functional than is the truncated protein produced when the ribosome stalls at the stop codon. Indeed, geneticists have conducted clinical trials of a drug called PTC124 on people with cystic fibrosis. This drug interferes with the ribosome’s ability to correctly read stop codons . On the basis of…
Mutations that introduce stop codons cause a number of genetic diseases. For example, from 2% to 5% of the people who have cystic fibrosis possess a mutation that causes a premature stop codon in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR). This premature stop codon produces a truncated form of CFTR that is nonfunctional and results in the symptoms of cystic fibrosis. One possible way to treat people with genetic diseases caused by these types of mutations is to trick the ribosome into reading through the stop codon, inserting an amino acid in its place. Although the protein produced may have one altered amino acid, it is more likely to be at least partly functional than is the truncated protein produced when the ribosome stalls at the stop codon. Indeed, geneticists have conducted clinical trials of a drug called PTC124 on people with cystic fibrosis. This drug interferes with the ribosome’s ability to correctly read stop codons (C. Ainsworth.…
Number the following steps of protein synthesis in order in which they occur, starting with 1 and ending with 9. a. ____ the stop codon is reached, and the polypeptide is released b.____ the small ribosomal subunit finds the start codon, and the large ribosomal subunit joins. c.____ the end of the gene is reached, and the pre-mRNA is released and then edited. d. ____ The transcription factor bonds the promoter. e. ____ the protein is folded and modified to become functional. f. ____ RNA polymerase builds the mRNA transcript. g. ____ mRNA and initiator tRNA bind the small ribosomal subunit. h. ____ new tRNAs are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site. i. ____ mRNA exits the nucleus via a nuclear pore.
Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. What effect on the polypeptide chain of factor IX would this new stop codon have?
the sequences od tRNA and corresponding mRNA is complementary to each other. is the statement true or false?