Identify the polypeptide that is found with a-globin in human fetal hemoglobin (first appearing in the late Jurassic, about 145 million years ago, with the origin of placental mammals from marsupials). e-globin (epsilon) g-globin (gamma) d-globin (delta) b-globin (beta)

Identify the polypeptide that is found with a-globin in human fetal hemoglobin (first appearing in the late Jurassic, about 145 million years ago, with the origin of placental mammals from marsupials). e-globin (epsilon) g-globin (gamma) d-globin (delta) b-globin (beta)

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Related questions

Q: When comparing the α-globin protein in cow and humans, you find that they differ at 20 of the 165…

A: Proteins are highly ordered sequences of amino acids. It is this amino acid sequence of the protein…

Q: giapis Below Show 02-binding curves of several proteins including myoglobin (Mb) and hemoglobin…

A: The graphs below show O2-binding curves of several proteins including myoglobin (Mb) and hemoglobin…

Q: What are the primary structures of TATA-binding protein (for ex. letter amino acids), What are the…

A: TATA-binding proteins (TBP) bind to Sequences on DNA called TATA boxes. TBP is a general…

Q: Considering TAGS, which of the following is false?

A: Triacylglycerols are tri-esters of fatty acids and glycerol.

Q: Based on the principles of RP-HPLC, which sub fraction in the figure (P1 to P8) is the most polar?…

A: HPLC (High Performance Liquid Chromatography): This method is used for protein purification. Here…

Q: Is myoglobin a motif, a domain, or a complete threedimensional structure?

A: Introduction: Myoglobin is an iron-containing protein that, like hemoglobin, can bind oxygen.A…

Q: What is β-globin gene ?

A: The process by which the characters are carried forward from the preceding generation to the…

Q: Explain why mutations occur in the CFTR?

A: The CFTR gene provides instructions for making a protein called the cystic fibrosis transmembrane…

Q: Can you please briefly define these five classes of domain folds.: α, β, α / β, α + β, and…

A: On a larger scale based on α and β secondary structures, the classes of domain folds are:- 1. α: In…

Q: Which of the following can you conclude about the hemoglobin in individuals with sickle cell anemia?…

A: The sickle cell anaemia is found because of sickle shaped red blood cells in place of normal concave…

Q: The earlier that two genes arose from a duplicated gene, themore their nucleotide sequences can have…

A: The HBB gene encodes instructions to form a protein known as beta-globin or hemoglobin beta. This…

Q: In BLOSUM62 matrix, a conserved Tryptophan position has score S(W,W) = 11, but a conserved Leucine…

A: BLOSUM is a block substitution matrix that is used to analyze and identify the best possible…

Q: Before this experiment, Dr Merrick didn’t know whether the OBP that he cloned was a type of…

A: Proteins can be monomeric or oligomeric. Monomeric proteins have a single subunit (single…

Q: Adult hemoglobin is a multimeric protein with fourpolypeptides, two of which are α-globin and two…

A: Haemoglobin is a protein that is responsible for oxygen transport in most of the vertebrates. This…

Q: Are there any globin pseudogenes in mammals? Explain.

A: Normal genes are made of the sequences of DNA that code for genes, responsible for the synthesis of…

Q: I read that vinyl chloride exposure is associated with an increased risk of a rare form of liver…

A: Cancer is the condition of uncontrolled cell division.

Q: A mutation in the promoter region of the gene for the beta-globin can cause betathalassemia, a…

A: Transcription is the synthesizing of RNA from DNA. Both eukaryotes and prokaryotes are transcribed…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 9. Generate a FULL protein sequence alignment for one of the…

A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: Explain Synpolydactyly caused by mutations in the human HoxD13 gene.

A: Synpolydactyly (SPD) is a rare congenital distal limb malformation, which is characterized by the…

Q: What does the third position imply when it comes to tRNA wobble effect and what the wobble effect…

A: Wobble base pairing : It is a pairing between two nucleotides in RNA molecules . The four main…

Q: A protein chemist told a molecular geneticist that he had found a new mutant hemoglobin in which…

A: A codon is a group of three consecutive nucleotides that specify an amino acid. Four different…

Q: is sickle-cell anemia life-threatening? if Sickle-cell anemia is a genetic disorder of homozygous…

A: Red blood cells in sickle-cell anaemia, an autosomal recessive condition, take on this morphology.…

Q: Why is gene duplication within globin genes beneficial?

Q: 18. Sketch curves of Y vs. O2 for myoglobin and hemoglobin on the same graph. In words, explain what…

A: In our body there are two proteins called myoglobin and hemoglobin. Their function is to carrier…

Q: How does gene expression change over time for the polypeptide components of hemoglobin?

A: There is a change in the polypeptide chains of the hemoglobin from the fetus till birth.

Q: The cytochrome P450 system metabolizes many medicinally useful drugs. Although all human beings have…

A: Genetic Polymorphism is the variation in DNA sequences of an individual that occur when nucleotides…

Q: How might P-elements have entered Drosophila melanogaster?What do you know about P-element…

A: P elements are transposable elements that were discovered in Drosophila as the causative agents of…

Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…

A: A silent mutation can be defined as the change in the sequence of nucleotide bases which constitutes…

Q: Which pathology leads to an increased risk of Alzheimer’s disease? Select one: a. Accumulation of…

A: Alzheimer's disease is a progressive disorder which affects the brain cells to waste away…

Q: Match the following protein pair with whther they are orthologues, paralogues or neither.…

A: Homologous genes are those gene that share a common evolutionary ancestor. A pair of homologous…

Q: How does hemoglobin bind O2 cooperatively? A. The binding of one molecule of O2 to one subunit of…

A: About 5 billion red blood cells are found in a milliliter of human blood. Each RBC contains around…

Q: Briefly explain how heme regulates the expression of globin genes in cells that synthesize…

A: Hemoglobin synthesis are global production and heme synthesis. Globin chain production occurs in the…

Q: Why might the locations of introns and exons be the same in both alpha- and beta-hemoglobin genes?

A: A phenomenon known as gene duplication arises due to 'unequal cossing over'. Due to unequal crossing…

Q: Which statements are associated with positively cooperative oxygen binding of a protein? A. The…

A: Haemoglobin is a tetrameric protein. It is a heterotetramer consisting of two alpha subunits and two…

Q: "Studies of Human Hemoglobin Established That One Gene EncodesOne Polypeptide" Define this ?

A: The theory that every gene is accountable for the synthesis of one polypeptide.

Q: Identical twins have been studied extensively to help us understand the inheritance of traits in…

A: Identical twins are born by splitting of the embryo into two so that each piece of embryo develops…

Q: The mutation causing sickle-cell anemia in humans, which changes the normal T to an A in the sixth…

A: Hemoglobin is a normal globin protein with heme (iron) in the red blood cells. It helps to…

Q: Sickle-cell anemia is a genetic disorder of individuals homozygous for a mutation of hemoglobin that…

A: Sickle cell anemia is an autosomal disease in which the red blood cells become sickle-shaped. In…

Q: Sickle cell disease results from a point mutation of the ______. α-globin of guanine for glutamine…

A: Sickle-cell disease: - RBC (Red blood cell) count decreases. - Anaemia condition

Q: 4. Figure shows a part of the sequence alignment of human and whale myoglobin proteins. Please…

A: Ans: Mutation: The change in the single nucleotide or multiple nucleotide which may results in loss…

Q: True or False: An IgM monomer can bind as many as 10 epitopes?

A: ADAPTIVE IMMUNE SYSTEM:- This system is a combination of two:- Lymphocytes and antigen-presenting…

Q: Why nonhomologous end-joining (NHEJ) is helpful ?

A: Non-homologous end joining (NHEJ) Is a repair process for double-strand DNA breaks. In contrast to…

Q: What is the expanded form of CRP ?

A: Amino acids are biomolecules that are comprised an amino group (-NH2) and a carboxyl group (-COOH).…

Q: Parents who both have "sickle-cell trait", i.e, are heterozygous for HbS have a child who is tested…

A: Sickle cell anemia is a blood disorder in which a mutation in one the hemoglobin genes causes the…

Q: How can a single nucleotide insertion in the beta globin gene generate a phenotypic change in the…

A: Thanks For Your Question. INTRODUCTION: Hemoglobin present in the RBC help in Oxygen transport from…

Q: Why is sickle-cell anemia life-threatening

A: Introduction Genetic disorders are those that are inherited from the parents to the next generation.…

Q: Draw 2 possible structures for each of the formulas; C6H8 and C6H6

A: A structural isomer is defined as a molecule with a similar chemical or molecular formula but a…

Concept explainers

Marine Evolution

Marine habitat is less explored, and hence, its biological diversity is far less known. The marine habitats are not constant due to their shifting nature, while the terrestrial habitats are more stable. Marine biology is the science that deals with the study of diverse marine species, their interactions, and behavioral characteristics.

Question

. Identify the polypeptide that is found with a-globin in human fetal hemoglobin (first appearing in the late Jurassic, about 145 million years ago, with the origin of placental mammals from marsupials).

e-globin (epsilon)
g-globin (gamma)
d-globin (delta)
b-globin (beta)
z-globin (zeta)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Based on the sensitivity of DNA to DNase I, as illustrated in Figure , which type of chicken hemoglobin (embryonic or adult) is likely to be produced in the highest quantity in the following tissues and developmental stages? Q. Brain cells throughout development
Consider the genes that specify the structure of hemoglobin. Arrange the following events in the most likely sequence in which they would take place.a. Anemia is observed.b. The shape of the oxygen-binding site is altered.c. An incorrect codon is transcribed into hemoglobinmRNA.d. The ovum (female gamete) receives a high radiationdose.e. An incorrect codon is generated in the DNA of ahemoglobin gene.f. A mother (an X-ray technician) accidentally stepsin front of an operating X-ray generator.g. A child dies.h. The oxygen-transport capacity of the body is severelyimpaired.i. The tRNA anticodon that lines up is one of a typethat brings an unsuitable amino acid.j. Nucleotide-pair substitution occurs in the DNA of agene for hemoglobin
What other possible organizations of the globin gene could exist if there were no need for a globin chaperone?
How many globin genes are present in mammals? What is the evidence indicating that all the globin genes in the mammalian genome are part of a family derived from a common ancestral globin gene?
Sickle cell anemia patients suffer from a distorted red blood cell shape and an anemic condition as a result of a genetic mutation in the HBB gene, which codes for the hemoglobin β subunits. This mutation changes a Glu to a Val at position 6 in the protein, and these patients express two alleles (one from each parent) with this mutation. When individuals inherit just one copy of this mutated gene, they are considered carriers, and have very few symptoms. Based on the quaternary structure of hemoglobin, what can you predict about the assembly of hemoglobin in sickle cell anemia patients versus carriers of the sickle cell trait? a. In sickle cell anemia patients, the α globin subunits have complementary mutations to ensure the quaternary structure of hemoglobin is attained. b. In sickle cell anemia patients, 100% of the hemoglobin is fully functional, whereas in those that carry the trait, there is no functional hemoglobin assembled. c. In individuals with the sickle cell…
Fetal hemoglobin binds to BPG to a lesser extent than does HbA because His 143 in the BPG binding pocket in β-globin has been replaced with a serine residue in γ-globin. As a result of the loss of two positive charges (one for each of two γ-globins), the binding pocket binds BPG less avidly. What are the consequences of this phenomenon for mother and fetus?
Sickle cell anemia is caused by a point mutation in the β-globin chain of hemoglobin. Glutamic acid is replaced by Valine. HBB sequence in normal adult hemoglobin (Hb A): Leu-Thr-Pro-Glu-Glu-Lys-Ser HBB sequence in mutant adult hemoglobin (Hb S): Leu-Thr-Pro-Val-Glu-Lys-Ser What effect does this mutation have on the structure and function of the protein? Predict what would happen to the RBC if the glutamic acid was replaced with asparagine instead of valine.
Using sickle-cell anemia as an example, describe what is meant by a molecular or genetic disease. What are the similarities and dissimilarities between this type of a disorder and a disease caused by an invading microorganism?
How can a single nucleotide insertion in the beta globin gene generate a phenotypic change in the ability of the red blood cell to transport oxygen?
Are there any globin pseudogenes in mammals? Explain.
Based on the sensitivity of DNA to DNase I, as illustrated in Figure , which type of chicken hemoglobin (embryonic or adult) is likely to be produced in the highest quantity in the following tissues and developmental stages? Q. Erythroblasts at day 5
If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?