some eukaryotic), indicate whether it is transcribed and transcribed and translated transcribed but not translated translated but not transcribed neither transcribed nor translated A. ribosome-binding site (prokaryotic) neither transcribed nor translated B. transcribed and translated intron transcribed but not translated promoter D. translated but not transcribed open reading frame

Q: The splicing process a. occurs in prokaryotes. b. joins introns together. c. can produce…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: Which statement/s is/are TRUE about transcription? A. During transcription, DNA polymerase binds to…

A: Transcription is the process that involved production of RNA from the DNA. this process occurs will…

Q: Match Column A with Column B. |Intron is removed from the MRNA transcript A 1st event v MRNA is…

A: Transcription is the mechanism by which mRNA is produced from template DNA in molecular biology. As…

Q: Which of the following statements is correct about eukaryotic gene expression?a. mRNAs must have…

A: Transcription is a process in which one strand of DNA known as template strand is known as converted…

Q: Prokaryotic cells can have more than one functional start codon per mRNA because  There are…

A: It is a multiple choice question

Q: mutation

A: Answer: Mutations in the promoter region resulted in a change in DNA binding pattern of the AP-2…

Q: (c) more than one protein to be produced by a gene

A: Gene can be defined as the basic physical and functional unit of heredity.

Q: Spliceosomes play central roles in .. a) removal of exons from pre-mRNA b) removal of introns from…

A: The mRNA transcribed from the DNA is heterogeneous mRNa or pre mRna which is not the final product.…

Q: For transcription to occur, the promotor region of DNA will a) Make a DNA copy of the DNA template…

A: RNA polymerase is the key central enzyme that regulates the transcription process. Prokaryotes need…

Q: Which gene regulation event is ONLY present in prokaryotes?  a. transcription level of regulation…

A:

Q: Which of the following statements about the spliceosome is false? a. A spliceosome splices pre-mRNA…

A: For RNA maturation there are about 40 different types of proteins and small RNAs that are called sn…

Q: You are a research scientist working in genetic engineering. You create a piece of DNA that you want…

A: Because of the remarkable efficiency with which DNA molecules are introduced into cells, E. coli is…

Q: How is transcription directly controlled in eukaryotic cells? a. through the use of phosphorylation…

A: Transcription refers to a process that transcribes the DNA molecule into a molecule called RNA which…

Q: That ribosomes wouldn’t bind to that gene b. No effect since the promoter doesn't have any coding…

A: Transcription take place when DNA sequence is bounded by various transcription factors that convert…

Q: Q. Ribosomes are “ribonucloprotein particles” in that they are composed mostly of rRNA with some…

A: Ribosomal proteins are made in the cytoplasm and then transported to the nucleus where they are…

Q: During translation, when a stop codon is read on the mRNA strand at the ribosome...  a the mRNA is…

A: Activation (getting ready), initiation (getting started), elongation (getting longer), and…

Q: Examining the DNA of a cancerous cell, a scientist would find strong expression of A. siRNAs. B.…

A: Option c i.e. oncogenes is the correct statement for the above question.

Q: All are stages in transcription EXCEPT: A chain termination. B DNase I activity on RNA…

A: Transcription is the process of conversion of RNA to proteins. It involves 3 steps initiation…

Q: Ribosomes that are translating a mRNA, would release that mRNA when they reach a) an operator b) a…

A: Introduction :- Ribosomes have two primary functions: message decoding and peptide bond synthesis.…

Q: A prokaryotic gene was transcribed then trans antibiotics X was added, and the products of t steps…

A: Antibiotic are the key substances which act on the major pathways of replication, transcription or…

Q: Which of the following functions is NOT typically attributed to small nuclear RNA (SNRNA)? A)…

A: Ribonucleic acid is a complex of the high molecular weight molecule that participates in cellular…

Q: Describe the process of transcription in prokaryotes

A: Since you have asked multiple questions we will answer the first question for you. If you want any…

Q: Transfer RNA ____________________. a. Carries amino acids to the ribosome b. Carries information…

A: The RNA is a biopolymer and the existence of complementary sequences on the RNA strand ensures that…

Q: A binding site for RNA polymerase is called a .a. gene c. codonb. promoter d. protein

A: Transcription is a process in which one strand of DNA known as template strand is known as converted…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: ranscription in eukaryotes; Oa) Occurs simultaneously with translation b) Does not require the RNA…

A: Transcription is the process of copying a segment of DNA into RNA.

Q: The portion of a gene that will be expressed in a protein is called a(an) a. Exon b. Intron c.…

A: A gene is a segment or region of DNA (deoxyribonucleic acid) that encodes for proteins or regulatory…

Q: Which of the following is LEAST likely to be transcribed into RNA? a) introns O b) promoters &…

A: Transcription is the process of conversion of DNA molecule into messenger RNA.

Q: A protein is normally secreted from the cell. A team of scientists attempts to redirect this protein…

A: Mutation can be defined as a change in the DNA sequence of a gene. In this case, a team of…

Q: cion 18 latch Column A with Column B. v transports amino acids to the site of protein synthesis A…

A: The ribonucleic acid consists of a single stranded structure which consists of a ribose sugar. It…

Q: Messenger RNA ____________________. a. Carries amino acids to the ribosome b. Carries information…

A: DNA is converted into mRNA, this process is known as transcription. mRNA is converted into protein,…

Q: Think of the eukaryotic gene expression process. Which column below accurately describes which…

A: RNA polymerase is a molecular enzyme that synthesizez RNA molecule from a DNA template. RNA…

Q: A scientist mutates eIF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of…

A: Selection of the AUG start codon for translation in eukaryotes is governed by codon-anticodon…

Q: Match the activity with the enzyme/proteins. v Scans the DNA to search for the promoter region A.…

A: DNA acts as the genetic material in most organisms. DNA gets transcribed into mRNA with the help of…

Q: In elongation, the creation of peptide bonds between amino acids is catalyzed by a. rRNA. b. a…

A: We know that the process of translation  involves formation of protein from the mRNA (messenger…

Q: The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene…

A: In molecular biology, mRNA is a single-stranded molecule of RNA that corresponds to the genetic…

Q: In eukaryotic cells, transcription cannot begin until(A) the two DNA strands have completely…

A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…

Q: A given coding strand sequence in a Eukaryote is as follows 5'GGGAATATAA GACCGATGGA GGGTACAG…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: Which of the following statements about gene expression is false?a) More than one RNA polymerase can…

A: DNA is a polynucleotide molecule, is a genetic material for most of the species on earth. The DNA…

Q: 1. Bradykinin peptide: a) The sequence of the gene that encoded it, indicating with different…

A: Note- As per guidelines, we are author to answer only first-three sub parts of first question only.…

Q: Think of the eukaryotic gene expression process. Which column below accurately describes which…

A: Genes include instructions for making proteins. They do not, though, produce proteins directly.…

Q: ce between prokaryotes and eukaryotes gene expression c) state the importance of regulating gene…

A: Genes  Genes are defined as nucleotide sequences on the DNA or RNA that specifies a functional…

Q: General transcription factors Select an answer and submit. For keyboard navigation, use the up/down…

A: The general transcription factors bind to other proteins or to a sequence element within the…

Q: Which of the following introns are usually removed from hnRNA only by spliceosomes? A.…

A: hnRNA stands for heterogeneous nuclear RNA. It refers to the large pre‐mRNAs of various nucleotide…

Q: what is the first event to take place in translation in eukaryotic cell? a. An clongation of the…

A: Translation is the process which is responsible for synthesis of protein from the mRNA.

Q: When would a ribosome bind to a promoter sequence? A) It wouldn't. A promoter is a DNA sequence, and…

A: Ribosomes bind to mRNA during the process of translation. Initiation of protein synthesis involves…

Q: Which of the following is true of ribosome rescue? (C & E wrong) A. The process produces a protein…

A: Ribosomes are present in prokaryotes as well as eukaryotes. mammalian…

Q: The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene…

A: The mRNA is produced from DNA by the process of transcriptions. The initiation of DNA transcription…

Q: All about RNA editing A. changing one or more nucleotides in the RNA transcript by deamination B.…

A: In this question when we look at options then we don't need to check B and C options as it's in…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.