cion 18 latch Column A with Column B. v transports amino acids to the site of protein synthesis A operator B. rRNA - v has anticodon loop C. IRNA v directs amino acid sequence of proteins D. MRNA v contains the Shine-Delgarno sequence E most type of RNA . v synthesized in the eukaryote nucleus F. promoter v found inside the ribosome

Q: Which of the fokmang the first event to take place in A base pairing of activated methionine-IRNA to…

A: Transcription is the process of making RNA copy of DNA. Translation is the process of making…

Q: 5) Answer the following questions about the Ribosome pictured below. a) What is the region of the…

A: Transcription  It can be defined as the synthesis of polypeptide chain by using mRNA. The synthesis…

Q: The anticodons are located in a.tRNA. b.rRNA. c.mRNA. d.ribosomes. e.endoplasmic reticulum.

A: Anticodons- An anticodon is a trinucleotide sequence complementary to that of a corresponding codon…

Q: A. Look at the MRNA message below. write the corresponding LRNA on the blank provided…

A: mRNA---  AUG AAG UUC CUG AUC  ---->( CODON: Sequence of three nucleotide that encodes a specific…

Q: Depict the RNA transcript in the box below 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA…

A: DNA and RNA are all made up of nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU -- 3' Write the amino acid sequence…

A: The nucleotide sequence in mRNA is translated to an amino acid by rules of genetic code. A codon…

Q: o In Prokaryotes, what is the function of the 5'UTR? A. It contains the start codon It contains the…

A: The 5′ untranslated region (5′ UTR) is the region of an mRNA that is directly upstream from the…

Q: Explain why the glucocorticoid receptor binds next to the core promoter of some genes, but not next…

A: Glucocorticoids are corticosteroids that are a class of steroid hormones. They are the…

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: Examining the DNA of a cancerous cell, a scientist would find strong expression of A. siRNAs. B.…

A: Option c i.e. oncogenes is the correct statement for the above question.

Q: 8. Some antibiotics work by preventing protein synthesis in bacteria by binding to their ribosomes.…

A: Multiple choice answer is given below:

Q: Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code…

A: DNA or deoxyribonucleic acid undergoes transcription and produces messenger RNA sequence in the form…

Q: All are stages in transcription EXCEPT: A chain termination. B DNase I activity on RNA…

A: Transcription is the process of conversion of RNA to proteins. It involves 3 steps initiation…

Q: The IRNA that was in the P site moves into the A site C. The tRNA that was in the A site moves to…

A: The process of protein synthesis is called translation. In this process transfer RNA, messenger RNA…

Q: Depict the RNA transcript in the box below 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA…

A: DNA undergoes the process of transcription to copy itself into RNA. The segments of RNA that can be…

Q: A prokaryotic gene was transcribed then trans antibiotics X was added, and the products of t steps…

A: Antibiotic are the key substances which act on the major pathways of replication, transcription or…

Q: Which two sequences shown in the diagram are NOT directly transcribed from the template strand of…

A: ANSWER - in this figure the following sequences are not directly transcribed from the template…

Q: 91 The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yes or…

A: Transcription is the process of RNA synthesis from the DNA template. It occurs within the nucleus of…

Q: Transcription is initiated when:   a. initiation factors assemble ribosomal subunits, mRNA, and…

A: Transcription:  It is Initial copying of the DNA strand with RNA Polymerase to make RNA. Before the…

Q: a. Write the sequence of the MRNA synthesized from the upper strand. b. Indicate the 5'and 3'ends of…

A: Answer : a. Sequence of mRNA synthesized from the upper stand - 5' AUGCCAUUUUGA 3' b. 5' and 3' ends…

Q: 7. A promoter is an example of a(n) O regulatory sequence. O chromatin sequence. O transposable…

A: A promoter is a DNA sequence that defines where transcription of a gene by RNA polymerase begins.…

Q: 2. If the DNA strand AAA TCG AGG CCA is transcribed to an mRNA, which 2 points shows an occurrence…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: ranscription in eukaryotes; Oa) Occurs simultaneously with translation b) Does not require the RNA…

A: Transcription is the process of copying a segment of DNA into RNA.

Q: emist 19.The last codon sequence in place on a strand of mRNA when a protein is being synthesized at…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: In which strand is the promoter? 5' TCATGAGATA GCCATGCATA TCTAGTATGT AGGCATCTGA GTTTATATCT CA 3' 3'…

A: Phosphodiester linkages connect DNA strands, which are polymers or chains of deoxynucleoside…

Q: Which of the following is LEAST likely to be transcribed into RNA? a) introns O b) promoters &…

A: Transcription is the process of conversion of DNA molecule into messenger RNA.

Q: Match Column A with Column B.…

A: transports amino acids to the site of protein synthesis- tRNA- tRNA is responsible for the transfer…

Q: 12) Which of the following processes occurs during transcription? A) DNA is replicated B) RNA is…

A: The information for the production of functional proteins are stored in segments of DNA called…

Q: 1.  Two closely related species may have a very similar genome size but very different number of…

A:

Q: B- TRANSCRIPTION 1. Use the DNA code provided to copy an mRNA message. (DNA) a. TAC GGA CAT (DNA) b.…

A: The central dogma explains that the information from the DNA will be passed in a sequence fashion…

Q: A gene with the following DNA sequence is transcribed and translated: 5’ TAGCTACGGAAAGCGTACACGGACT…

A: Transcription is the process of the formation of RNA from the DNA template strand.

Q: ? 1. mRNA is formed with codons as product ons are translated and polypeptide chain is tr es into…

A: Genetic material- DNA and RNA acts as the genetic material in most of the organisms . DNA stands…

Q: c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the…

A: Introduction :- In moelcular biology , the expression of gene is the most important event , that…

Q: Jesse is a cat from an old cartoon. The show was only produced in black and white, and Jesse now…

A: Given, ACC GCG GTT TAC TTT GCC CGA ATT GAT GA

Q: 3. snRNA is produced in transcription. 4. Initiator tRNA enter ribosome with the help of EF-Tu. 5.…

A: Transcription is the process of synthesis of RNA. The process of transcription requires RNA…

Q: A. Taq polymerase B. Release factors C. Reverse transcriptase D. CDNA 1. Catalyzes peptide bond…

A: 1.  H peptidyl transferase  2.  G aminoacyl  tRNA synthetase 3.  K  shine dalgarno sequence 4. I…

Q: 8. The CAS9 enzyme (shown in red in the image below arget and cut out specific DNA sequences.

A: As you have not mentioned which part to answer, we are answering first three for you. If you want…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: DNA is the genetic material in most organisms. It is the information hub of the cell that contains…

Q: 1. Bradykinin peptide: a) The sequence of the gene that encoded it, indicating with different…

A: Note- As per guidelines, we are author to answer only first-three sub parts of first question only.…

Q: The job of tRNA is to O A. bring amino acids to the ribosome by matching their anticodon to the…

A: The genetic material is used to store the genetic information in the mitochondria or nuclei of an…

Q: During translation

A: The translation involves the synthesizing proteins through ribosomes in the cytoplasm or endoplasmic…

Q: e string of amino acids occupying a channel between TFIIK (CAK of TEUL

A: String of aminoacids occupying a channel between TFIIK and Med31 CTD of the largest subunit of the…

Q: A function of transfer RNA (ERNA) is to: O copy DNA and carry the information to the ribosome stay…

A: A transfer RNA is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length,…

Q: 3. Inducers: a. transcribe a messenger off a DNA template b. bind to ribosomes to activate the…

A: In a gene, there is a region called promoter where RNA polymerase begins to transcribe a gene. The…

Q: 5’ UGG CAA UCC UAC GAU 3’   Write out the sequence of the anticodon in the tRNA that would bind to…

A: Note: As per the guidelines only one question has to be answered. Please ask the other question…

Q: MicroRNAS attach to MRNA. In doing this, they... O Lead to the production of more protein O Lead to…

A: The control of gene expression through micro RNA is dones mainly by binding with the messenger RNA…

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The central dogma The central dogma is the process involving three major events in cells these are…

Q: The regulatory activity of sRNA A) O codes for a sigma factor. B) O blocks access of RNA polymerase…

A: The structure of the DNA is copied by a process named DNA replication. After this, this DNA goes…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.