BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
10th Edition
ISBN: 9781305967359
Author: STARR
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 14SA
Energy that drives translation is provided mainly by ______ .
| a.
|
c.
|
| b. amino acids | d. ribosomes |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
When the ribosome "reads" the codon UAG, UGA or UAA...
A) the polypeptide is released from ribosome but ribosome continues reading the mRNA
B) the proper tRNA enters the ribosome
C) translation begins
D) polypeptide is released from the ribosome and translation ends
Treating a cell with a drug to stop tRNA from doing its job would mean what?
A. that ribosomes would fall apart
B. that sugars woulf not be added to proteins
C. that nothing would be available to translate
D. that amino acids would not be brought to the growing protein.
A single template strand of a DNA molecule is represented by
3’atgtaccatgcgcaaatttaaaggccc5’.
a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications?
b) Write the amino acid sequence of your mature mRNA.
c) List the molecules involved in translation and briefly describe their function.
Chapter 9 Solutions
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Ch. 9 - A chromosome contains many different gene regions...Ch. 9 - A binding site for RNA polymerase is called a...Ch. 9 - An RNA molecule is typically _________ ; a DNA...Ch. 9 - RNAs form by ______ ; proteins form by ________ ....Ch. 9 - Prob. 5SACh. 9 - Prob. 6SACh. 9 - Energy that drives transcription is provided...Ch. 9 - Most codons specify an _________ . a. protein c....Ch. 9 - Anticodons pair with _______ . a. mRNA codons c....Ch. 9 - What is the maximum number of amino acids that can...
Ch. 9 - _______ are removed from new mRNAs. a. Introns c....Ch. 9 - Where does transcription take place in a...Ch. 9 - Where does translation take place in a eukaryotic...Ch. 9 - Energy that drives translation is provided mainly...Ch. 9 - Put the following processes in order of their...Ch. 9 - Prob. 16SACh. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the sequence of bases in the previous...Ch. 9 - Prob. 6CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following best describes mRNA?Group of answer choices a) Complexes with ribosomal proteins to form ribosomes b) Transports amino acids to ribosomes during translation c) Provides the instructions for the amino acid sequence of a polypeptide d) Used for eukaryotic RNA processingarrow_forwardOnce translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?arrow_forward1. Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.arrow_forward
- What site on the ribosome is the place where a tRNA molecule leaves the ribosome after attaching its amino acid to the growing chain of amino acids? a. E site b. P site c. A site d. the small ribosomal subunit Please respond as soon as possiblearrow_forwardA particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an mRNA transcript contains the codon for this tRNA? A. The tRNA will not bind to this codon. B. Translation stops and the protein is released. C The wrong tRNA is added to the protein chain. D. Translation stops and the protein remains bound to the ribosome.arrow_forwardImagine that a mutation in a DNA molecule results in the codon CCU being changed to CCC. Both of these codons code for proline. The fact that more than one codon can code for the same amino acid is referred to as ___ a. the ambiguity of the genetic code b. the redundancy of the genetic code c. the randomness of the genetic code d. mutations in the genetic codearrow_forward
- If a eukaryotic mRNA has failed to have a cap attached to its 5' end, what would the negative consequence(s) be? I chose b and got this questions wrong, why is this wrong? a. The mRNA would not properly exit the nucleus. b. The mRNA would not properly bind to a ribosome. c. The mRNA would not receive a poly A tail. d. The mRNA would not use the correct start codon. e. Both a and b are correct.arrow_forwardWhich steps in eukaryotic translation require the cleavage of a phosphodiester bond from GTP? Choose one or more: A. release of EF–Tu B. formation of a peptide bond C. formation of the 80S ribosome D. release of the new polypeptide chain E. translocation of the ribosome along the mRNAarrow_forwardWhich of the following best describes tRNA? a. Provides the instructions for the amino acid sequence of a polypeptide b. Complexes with ribosomal proteins to form ribosomes c. Used for eukaryotic RNA processing d. Transports amino acids to ribosomes during translationarrow_forward
- Specific amino acids attached to molecules of tRNA, while antocodons align with codons of mRNA describes, in part a.replication b.transcription c.translation d.recombinant DNA formation e.cellular activationarrow_forwardTranslation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCUarrow_forwardWhich enzyme links amino acids together? (a) ribozyme (b) peptidyl transferase (c) DNA polymerase I (d) RNA polymerase II (e) amino-acyl tRNA synthetasearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license