Some molecules found in foods are known to be capable ofdriving DNA methylation or DNA demethylation. For example,folic acid (a vitamin), vitamin B12, and choline are thought toincrease methylation. Based on this consideration, why wouldit be important to avoid eating excessive quantities of suchmolecules (while being certain to eat sufficient quantities forhealth)?

Some molecules found in foods are known to be capable ofdriving DNA methylation or DNA demethylation. For example,folic acid (a vitamin), vitamin B12, and choline are thought toincrease methylation. Based on this consideration, why wouldit be important to avoid eating excessive quantities of suchmolecules (while being certain to eat sufficient quantities forhealth)?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

Richard Boyce and Paul Howard-Flanders conducted an experimentthat provided biochemical evidence that thymine dimers areremoved from DNA by a DNA repair system. In their studies, bacterialDNA was radiolabeled so the amount of radioactivity reflectedthe amount of thymine dimers. The DNA was thensubjected to UV light, causing the formation of thymine dimers. When radioactivity was found in the soluble fraction, thymine dimershad been excised from the DNA by a DNA repair system.But when the radioactivity was in the insoluble fraction, the thyminedimers had been retained within the DNA. The following tableillustrates some of the experimental results involving a normalstrain of E. coli and a mutant strain that was very sensitive to killingby UV light: Explain the results found in this table. Why is the mutant strainsensitive to UV light?
Suppose you are a research assistant ina lab studying DNA-binding proteins. You have been giventhe amino acid sequences of all the proteins encoded bythe genome of a certain species and have been asked to findcandidate proteins that could bind DNA. What type of aminoacids would you expect to see in the DNA-binding regions ofsuch proteins? Explain your thinking.
In the early 1950s, it became clear to many researchers that DNAwas the cellular molecule that carries genetic information. However,an understanding of the genetic properties of DNA couldonly be achieved through a detailed knowledge of its structure.To this end, several laboratories began a highly competitive raceto discover the three-dimensional structure of DNA, which endedwhen Watson and Crick published their now classic paper in 1953.Their model was based, in part, on an X-ray diffraction photographof DNA taken by Rosalind Franklin (Figure 9.10). Two ethical issuessurround this photo. First, the photo was given to Watson and Crickby Franklin’s co-worker, Maurice Wilkins, without her knowledge orconsent. Second, in their paper, Watson and Crick did not creditFranklin’s contribution. The fallout from these lapses lasted fordecades and raises some basic questions about ethics in science. What vital clues were provided by Franklin’s work to Watsonand Crick about the molecular structure…
Considering that genes can code only for RNA orproteins, how can the synthesis of nonprotein substancessuch as carbohydrates or steroids be under geneticcontrol?
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
An interesting trait that some bacteria exhibit is resistance to beingkilled by antibiotics. For example, certain strains of bacteria areresistant to tetracycline, whereas other strains are sensitive to tetracycline.Describe an experiment you would carry out to demonstratethat tetracycline resistance is an inherited trait encoded bythe DNA of the resistant strain.
If DNA polymerase requires a perfectly pairedprimer in order to add the next nucleotide, how is it thatany mismatched nucleotides “escape” this requirementand become substrates for mismatch repair enzymes?
Two circular DNA molecules, which we can call molecule A andmolecule B, are topoisomers of each other. When viewed under theelectron microscope, molecule A appears more compact than molecule B. The level of gene transcription is much lower for molecule A. Which of the following three possibilities could accountfor these observations?First possibility: Molecule A has three positive supercoils, andmolecule B has three negative supercoils.Second possibility: Molecule A has four positive supercoils, andmolecule B has one negative supercoil.Third possibility: Molecule A has zero supercoils, and molecule Bhas three negative supercoils.
. The physicist Stephen Hawking, famous for his theories about black holes, has lived past the age of 70 withamyotrophic lateral sclerosis (ALS), a paralyzing neurodegenerative disease that is usually fatal at a muchyounger age. Recently, geneticists discovered that amajor cause of ALS is the unusual expansion of ahexanucleotide repeat (5′-GGGGCC-3′) that lieswithin a gene called C9ORF72, at a location outside ofthe gene’s open reading frame (ORF). A single expanded allele is sufficient to cause ALS, but the reasonthe disease allele is dominant remains unclear. Someexperimental results support the theory that the allelemakes a toxic RNA containing the expanded repeat. Ifthis theory is correct, in what ways is the mutant ALScausing allele similar to the mutant allele that causesHuntington disease? In what ways is it similar to themutant allele that causes fragile X syndrome?
Null mutations are valuable genetic resources becausethey allow a researcher to determine what happens to anorganism in the complete absence of a particular protein. However, it is often not a trivial matter to determinewhether a mutation represents the null state of the gene.a. Geneticists sometimes use the following test forthe nullness of an allele in a diploid organism: If theabnormal phenotype seen in a homozygote for theallele is identical to that seen in a heterozygote(where one chromosome carries the allele in question and the homologous chromosome is known tobe completely deleted for the gene) then the alleleis null. What is the underlying rationale for thistest? What limitations might there be in interpreting such a result?b. Can you think of other methods to determinewhether an allele represents the null state of a particular gene?
A temperature-sensitive mutation is one in which the defect is not presented functionally until the temperature is raised. In the case described below, the enzymes function normally in bacteria at 37 °C, but are non-functional at 40 °C. Predict the detailed molecular consequences of a loss of function in a temperature-sensitive mutant for each of the following enzymes: a) DNA gyrase, b) DNA polymerase III, c) DNA ligase, d) DNA polymerase I.
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provideanswers for the following questions?1) Define the silent mutation in DNA? (2.5 marks)2) What is the codon usage bias? (2.5 marks)3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics? (10.0 marks)