DnaA proteins bind to repeated binding sites on the DNA double helix, helping to recruit the helicase enzyme OItihvolves a DNA region rich in A-T sequences, which collectively have weaker hydrogen bonding interactions that make this region easier to separate into single strands There typically is only one OriC site with one replicon in prokaryotes, while eukaryotes have many OriC sites with multiple replicons Two functional replication forks are assembled after the OriC site is opened, leading to two replisomes moving in opposite directions The location of OriC sites along the chromosome can vary from generation to generation, especially in regard to eukaryotic DNA synthesis

DnaA proteins bind to repeated binding sites on the DNA double helix, helping to recruit the helicase enzyme OItihvolves a DNA region rich in A-T sequences, which collectively have weaker hydrogen bonding interactions that make this region easier to separate into single strands There typically is only one OriC site with one replicon in prokaryotes, while eukaryotes have many OriC sites with multiple replicons Two functional replication forks are assembled after the OriC site is opened, leading to two replisomes moving in opposite directions The location of OriC sites along the chromosome can vary from generation to generation, especially in regard to eukaryotic DNA synthesis

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Similar questions

How does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.
Which of the following statements about DNA replication is INCORRECT? It is powered bythe hydrolysis of ATP. Each strand withinthe DNA double helix is used as a template for synthesis of a new strand. It requires that both strands of the double helix be separated from each other. It proceeds withthe addition of new nucleotides to the 3′ end of a growing DNA strand. It begins atmultiple origins of replication sites along eukaryotic chromosomes.
Which of the following statements about the DNA replication is false? a. Synthesis of the new DNA strands is form 39 to 59 b.Synthesis of the new DNA strands is from 59 to 39 c. DNA Unwinds, primase adds RNA primer, DNA polymerases synthesize the new strand and remove the RNA primer d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite direction from the direction in which the replication for moves.
During DNA replication, the function of RNA primers is to Group of answer choices serve as a binding site for DNA ligase separate the two strands of the double helix to open replication "bubbles" serve as starting points for DNA strand elongation by DNA polymerase in the 3' - 5' direction prevent new-separated strands of DNA from rejoining serve as starting points for DNA strand elongation in the 5' - 3' direction by DNA polymerase
The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’
In relation to central dogma of molecular biology answer the following questions: A- Give two reasons why the DNA replication is asymmetrical process (i.e. the DNA replication outcome is different between the leading and lagging strands)? B-The following segment of DNA is part of the transcription unit of a gene. You know already that RNA polymerase moves in a specific direction along this piece of DNA to convert one of the DNA strands into a single strand RNA transcript so that this entire region of DNA is made into RNA. 5′-GGCATGGCAATATTGTAGTA-3′ 3′-CCGTACCGTTATAACATCAT-5′ Given this information, a student claims that the RNA produced from this DNA is: 3′-GGCATGGCAATATTGTAGTA-5′ Give two reasons why this answer is incorrect. C- Imagine that the mRNA codons consisted of only two nucleotides instead of three nucleotides. Would there be a sufficient number of codons for all twenty amino acids? Explain your answer. D- The length of a particular gene in human DNA,…
Arrange the following events of DNA replication in the proper order. A. DnaA binds DNA B. DNA polymerase binds to a free 3’ – OH C. Topoisomerases act D. Ori “melts/denatures”
The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer sequences below would be synthesized from this strand by DNA primase to initiate DNA replication? Group of answer choices a 3'—TTAACGTCTAAGT—5' b 3'—UUAAGCUCUAAGU—5' c 5'—TTAACGTCTAAGT—3' d 5'—UUAAGCUCUAAGU—3'
What is the difference between the leading strand and the lagging strand in DNA replication? There are different DNA polymerases involved in elongation of the leading strand and the lagging strand. The leading strand is synthesized continuously in the 5' → 3' direction, while the lagging strand is synthesized discontinuously in the 5' → 3' direction. The leading strand requires an RNA primer, whereas the lagging strand does not. The leading strand is synthesized in the 3' → 5' direction in a discontinuous fashion, while the lagging strand is synthesized in the 5' → 3' direction in a continuous fashion.
Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication? a. Both eukaryotic and prokaryotic DNA polymerases build off RNA primers made by primase. b. Eukaryotic DNA replication requires multiple replication forks, while prokaryotic replication uses a single origin to rapidly replicate the entire genome. c. DNA replication always occurs in the nucleus. d. Eukaryotic DNA replication involves more polymerases than prokaryotic replication.
Which of the following statements are TRUE?I. DNA replication is a semiconservative process wherein the two resulting double helices consist of one new strand and one parental strand.II. The DNA strand that is used to make a complementary daughter strand is called the parental strand.III. The precursor of each new nucleotide in the DNA strand is a deoxynucleoside 3′-triphosphate.IV. The incoming nucleotide always attaches to 5′-phosphate of the previously added nucleotide
Which of the following statements are TRUE?I. DNA replication is a semiconservative process wherein the two resulting double helices consist of one new strand and one parental strand.II. The DNA strand that is used to make a complementary daughter strand is called the parental strand.III. The precursor of each new nucleotide in the DNA strand is a deoxynucleoside 3′-triphosphate.IV. The incoming nucleotide always attaches to 5′-phosphate of the previously added nucleotide a. I only b. II only c. I and IV d. III and IV