The actions of the mismatch repair system become especially critical in regions of DNA that carry ________________sequences. A. Deleted B. New C. Old D. Repeated E. Both A and D
Q: In an EMSA, the binding of a protein to DNAa. prevents the DNA from being digested with a…
A: Electrophoretic mobility shift assay (EMSA) is used to identify deoxyribonucleic acid (DNA)-binding…
Q: A key difference between the original Holliday model and the double-strand break model is the way…
A: Answer is c.) a heteroduplex is formed.
Q: A. A plasmid is shown with the locations of various restriction enzyme sites labeled. If you cut the…
A: if we cut the plasmid with XhoI and XbaI then we will get three fragments of following sizes 1000…
Q: purpose(s) of DNA extraction
A: The purpose of DNA extraction are: To study the genetic cause of the disease. For the development…
Q: The original DNA base sequence is 5’-AGCGTTACCGT-3’; a mutation in the DNA strand results in the…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: 1. Why do you think SNPS are more commonly found in intergenic regions ? a.Because intergenic…
A: Single nucleotide polymorphism (SNP) is the change in the single nucleotide through addition or…
Q: 5.State the contribution of the following scientists to the understanding of DNA structure: a)Erwin…
A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…
Q: Why must the lagging strand of DNA be replicated in short pieces a. Because of limited space b. To…
A: The replication of the DNA takes place in a semiconservative pattern in which the DNA duplex unwinds…
Q: 2. a. Research DNA quantitation by UV absorption. Explain what A230, A260 and A280 values represent.…
A: Every biomolecule have an unique absorbance curve of their own. This simply means that, the…
Q: DNA synthesis has a very low error rate. One reason for this is that the DNA polymerase enzyme can…
A: DNA polymerase is the enzyme that does maximum of the work throughout DNA replication. It builds a…
Q: How does the Cas9 endonuclease bind to specific sequences of DNA in order to make cuts? A. It…
A: Cas9 is a 160-kilodalton protein that plays a key part in certain bacteria's immunological defence…
Q: a) Explain the effect of the guanine:cytosine ratio on melting temperature of DNA. b) The…
A: (a) Guanine : cytosine ratio is the ratio of base pairs in the DNA. There are four bases in DNA -…
Q: #1 under Identify the Structures is what.... A. original strands of DNA B. backbone of DNA C.…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule which is the genetic material in…
Q: In nucleotide excision repair in E. coli, the function of the UvrA/UvrB complex is toa. detect DNA…
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. DNA replication is the process by which…
Q: Answer the following Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’…
A: The central dogma depicts the flow of genetic information into cells, the replication of genomic…
Q: a. This piece of DNA is cut by EcoRI, the resulting fragments are separated by gel electrophoresis,…
A: Gel Electrophoresis is a separation technique which is used to separate fragments like DNA, RNA or…
Q: )A scientist compares the sequence of a disease gene and a healthy gene and finds that these two…
A: The gene is the unit of heredity that is carried out from the parents to the offspring. This…
Q: What is the use of Liquid soap in DNA extraction?* A. binds cell membrane and nuclei B. dissolves…
A: DNA extraction is a process of extracting DNA from the cell for further experiments. It is a method…
Q: 8. Circle the choice that best describes the statements or answers the questions below. Multiple…
A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…
Q: One common feature of all DNA polymerases is that they a. synthesize DNA in the 3′-to-5′…
A: One common feature of all DNA polymerases is that they synthesize DNA in the 5'-3' direction.
Q: In order to target a specific region of genomic DNA with CRISPR, researchers must include a guide…
A: Abstract The CRISPR-Cas9 system, naturally a defense mechanism in prokaryotes, has been repurposed…
Q: Identify the Mutations 1. Original Strand Mutant Strand GGGCTAGGGCCAA GGGGCTAGGGCCAA Types of…
A: Mutations are the gradual changes that occur in our DNA sequence because of several factors such as…
Q: What type of mutation caused Nicholas’s disease?a. frameshift b. missense c. nonsense d. insertion
A: Nicholas’s disease Nicholas’s disease is broadly known as the sickle cell disease. In this disease,…
Q: The dideoxynucleosides ddATP, ddTTP, ddGTP, and ddCTP were important in DNA sequencing because they…
A: Dideoxynucleotides are DNA polymerase chain-elongating inhibitors used in the Sanger technique of…
Q: The action of ultraviolet radiation on DNA to induce mutation is the…
A: The DNA sequence is extremely important as it is used as template for replication and protein…
Q: 25. The restriction enzymes Kpnl and Acc65l recognize and cleave the same 6-bp sequence. You have a…
A: Restriction enzymes are the DNA digesting enzymes.
Q: DNA polymerases ____. a. add new nucleotides to a strand b. repair DNA c. assemble new…
A: DNA replication is heterocatalytic process by which a new DNA strand is synthesized on a old DNA…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…
A: DNA (deoxyribonucleic acid) is a double-stranded nucleotide sequence that is intertwined and…
Q: Mismatch repair in E. coli distinguishes between old and new strands of DNA on the basis of a.…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: Which type of cells were used to extract the DNA that was sequenced? a. red blood cells c. white…
A: 1) Extraction of DNA is a very lengthy process; it can be extracted from any cell, either…
Q: Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the…
A: Given: Original DNA template: 3' - ACGGTCAATTTGCTG - 5'
Q: What will most likely be the effect of the change in the DNA molecule? * A. the change will cause…
A: The DNA content of the organism represents the total genetic content and so the total genes present…
Q: SSBS are: A single-stranded bodies called Okazaki fragments. B substrates for DNA ligases. ©…
A: The biological information flows through genes. DNA is the main genetic material of most of living…
Q: You are studying a colony of cells and determine that some of these cells have a mutated DNA…
A: Deoxyribonucleic acid (DNA) is a hereditary molecule that passes genetic information from one…
Q: i the polymerase chain reaction, the DNA denaturation step requires a emperature in the range of ?°…
A: SOL1 In humans, fertilization is the fusion of a human egg or female gamete and sperm or male gamete…
Q: You used agarose gel electrophoresis to separate DNA fragments of different size and the experiment…
A: Agarose gel electrophoresis is a method to separate, identify and purify the DNA molecules.…
Q: 1. What is the basis of separation of different DNA fragments by gel electro- phoresis? a. The…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: When E. coli cells are mixed with recombinant vector DNA and subject to a stress such as heat shock,…
A: Prokaryotes are the single celled organisms (unicellular) and are the simplest form, which do not…
Q: Which of the following types of mutations are advantageous to cancer cell growth? a. Those…
A: DNA is the genetic material present in the genome of organisms.
Q: 1. A linear DNA molecule is subjected to complete restriction digestion by (1) EcoR1 alone, (2)…
A: Restriction enzyme or restriction endonuclease are bacterial protein that cleaves DNA at specific…
Q: 94. Which of the following is TRUE of DNA polymerases of eukaryotic cells? a. The same DNA…
A: DNA polymerase is typically used in the DNA replication process. Beta DNA polymerase is a subtype…
Q: The basis for DNase I footprinting is that the binding of a proteinto DNAa. prevents the DNA from…
A: The DNase I footprinting is a crucial technique that is used to study the detailed interaction…
Q: . A short homologous sequence called the macrohomologies which connects break ends of the strands.…
A: Short Homologous sequence Is known as Microhomology sequence. It involves asingment of…
Q: Which of the following statements describe reversal of DNA repair mechanism. A. UV light blocks the…
A: Solution : correct option is C
Q: A certain mutant DNA polymerase is error-prone, tending to incorporate C opposite a template A. When…
A: Mutations in the DNA polymerase would affect the process of replication. It is studied under the…
Q: 72) In case of RNA dependent RNA polymerase in Newcastle disease virus (NDV), is a a. Its template…
A: Introduction - Newcastle disease virus (NDV) is a virus that causes serious infection in birds and…
Q: Part A: Antibiotic resistance is a major health concern. Resistance to various antibiotics can be…
A: When the existence of antibiotics and antifungals forces bacteria and fungi to adjust, antimicrobial…
Q: DNA Repair Systems a. counteract spontaneous and induced mutations b. counteract induced mutations…
A: DNA repair may be classified as a collection of systems that detect and repair damage to DNA…
Step by step
Solved in 2 steps
- The problem of synthesizing the lagging strand, in the sense that DNA synthesis can only occur in one direction, is manifested inA. creation of primers every so often as more of the template strand isuntwisted.B. formation of shorter DNA strands called Okazaki fragments.C. the need for the enzyme ligase to link short DNA strands together.D. All of the above choices are correct.a mutation in dna that adds +1 ot -1 nucleotide or +2 or -2 nucleotides is called a______? (choose one answer only) A. frameshift mutation B. silent mutation C. nonsense mutation D. missense mutationWhich type of cells were used to extract the DNA that was sequenced? a. red blood cells c. white blood cells b. intestinal epithelium d. cheek swab What type of mutation caused Nicholas’s disease? a. frameshift c. nonsense b. missense d. insertion
- VII. Rosalind Franklin (Early 1950s) A. What did she discover about the probable shape of DNA? B. What controversy surrounds Rosalind Franklin?What kind of mutation normally has no consequence? please explain the answer a.transversions b.insertion c.silent d.nonsenseWhat type of mutation caused Nicholas’s disease?a. frameshift b. missense c. nonsense d. insertion
- Base analogs are mutagenic because of which characteristic? a. They produce changes in DNA polymerase that cause it to malfunction. b. They distort the structure of DNA. c. They are similar in structure to the normal bases. d. They chemically modify the normal bases.Why are mutations more likely to occur in repeated DNA sequences? a. These bases are unstable b. bases in the strand can form base pairs, generating loops that interfere with replication and repair enzymes. c. The repeats hold onto the replication enzymes, causing base mismatches d. the repeats attract and bind to mutagens, increasing the mutation rateThe action of ultraviolet radiation on DNA to induce mutation is the Select one: a. methylation of base pairs b. deletion of base pairs c. formation of thymine dimers d. addition of base pairs
- Xeroderma pigmentosum is a genetic disease caused by an error in the nucleotide excision repair process that fixes damage to DNA by ultraviolet light. Studies have shown that it can result from mutations in any one of seven genes. What can you infer from this finding? A) There are seven genes that produce the same protein B) These seven genes are the most easily damaged by ultraviolet light. C) There are seven enzymes involved in the nucleotide excision repair process. D) These mutations have resulted from translocation of gene segments.The original DNA base sequence is 5’-AGCGTTACCGT-3’; a mutation in the DNA strand results in the base sequence 5’-AGGCGTTACCGT-3’. What can you conclude about the mutation? A. It is a frameshift mutation. B. It is a silent mutation. C. It is a deleterious mutation. D. It may result in a single amino acid change in the protein being coded for by this base sequence.Match the E. coli mismatch repair enzyme on the left with the appropriate function on the right. MutS MutH MutL a. facilitates the looping of the region of DNA to be replaced b. distinguish between parental and newly-synthesized DNA c. locates mismatches in the DNA