1. Why do you think SNPS are more commonly found in intergenic regions ? a.Because intergenic regions code for proteins that can tolerate mutations much better than regulated genes b.Because intergenic regions are made of sequences of single nucleotides, whereas coding regions are made of sequences of tri-nucleotides called codons c.Because DNA polymerase is more likely to make replication mistakes in intergenic regions than within gene sequences d.Because changes to nucleotides within genes (either in promoters or coding sequence) are more likely to have phenotypic effects, and be selected against through evolution.

1. Why do you think SNPS are more commonly found in intergenic regions ? a.Because intergenic regions code for proteins that can tolerate mutations much better than regulated genes b.Because intergenic regions are made of sequences of single nucleotides, whereas coding regions are made of sequences of tri-nucleotides called codons c.Because DNA polymerase is more likely to make replication mistakes in intergenic regions than within gene sequences d.Because changes to nucleotides within genes (either in promoters or coding sequence) are more likely to have phenotypic effects, and be selected against through evolution.

Name: 1. Why do you think SNPS are more commonly found inintergenic regions
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 1. Why do you think SNPS are more commonly found inintergenic regions ?a.Because intergenic regions code for proteins that cantolerate mutations much better than regulated genesb.Because intergenic regions are made of sequences ofsingle nucleotides,

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

3. Now that the sequence of the entire E. coli K12 straingenome (roughly 5 Mb) is known, you can determineexactly where a cloned fragment of DNA came fromin the genome by sequencing a few bases and matching that data with genomic information.a. About how many nucleotides of sequence information would you need to determine exactly where afragment is from?b. If you had purified a protein from E. coli cells,roughly how many amino acids of that proteinwould you need to know to establish which geneencoded the protein?c. You determine 100 nucleotides of sequence ofgenomic DNA from a different E. coli strain, butyou cannot find a match in the E. coli K12 genomesequence. How is this possible?
8. As explained in the text, the cause of many geneticdiseases cannot yet be discerned by analyzing wholeexome/genome sequences. But in some of theseseemingly intractable cases, important clues can beobtained by looking at mRNAs or proteins, ratherthan at the DNA.a. As you will see in more detail in later chapters, it ispossible to use single-molecule methods to sequence cDNA copies of millions of mRNA molecules from any particular tissue cheaply. Howcould you sometimes use such information to finda disease gene? When would this information benoninformative?b. A technique called Western blotting allows you toexamine any protein for which you have an antibody; it is possible to see differences in size oramount of that protein. How could you sometimesuse such information to find a disease gene? Whenwould this information be noninformative?
A binding .site for RNA polymerase is called a ___ . a. gene b. promoter c. codon d. protein
1. Evaluate the statement that "exceptions" exist to the Universal Genetic Code. Examinepossible significance of such "exceptions" and present models consistent with available data toexplain possible origins for such exceptions. In other words, provide a possible step-by-step setof conditions to explain ho at least one example exception might have occurred, includingselective pressures leading to the change(s).
1- You are studying lung cancer and use a microarray to compare gene expression between a lung cancer tumor and healthy adjacent lung tissue. If you label vour cancer cDNAwith red fiuorescence and your normal tissue with green, what color would you expect tumor suppressors to be:© a. GreenU D. RedOc.No color) d. Either Red or Green© e Yellow 2- You want to study histone modifications using Next Generation sequencing. What technique would allow you to do this?© a, Sanger sequencing© b. Fluorescence in situ hybl© c. RNA-SeqOld. ChIP-sed© e. Poymerase Chain Reaction 3-Gertrudae mcfuzzi is a rare (and ficticious) species of bird with colorful tail feathers. All Gertrude mcfuzzi develop 1 tail feather when they are born, and can grow additionaltall teathers during matunty depending on the alleles they inherit at a number of additive loci (T, S, and G) which form the geise/-complex. Each positive (+) allele adds one lalfeather and each negative - allele produces no additional feathers, based…
2) The authors investigate if the switch from the polymerase to the exonuclease site involves releasing and re-binding of the DNA or if it utilizes an intramolecular rearrangement. To accomplish this, they use a primer-extension assay. How is a primer extension assay performed? In answering this question, be sure to mention a.) why heparin is used, b.) how they generate mismatched primers, and c.) how they visualize only the primer strand and not the template strand on their gel.
1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
1.Your goal is to design a strategy to create thisfinal pDHFR plasmid for fusion protein expressionfrom the materials available:You have an empty pET21a expression vector and another vectorthat contains the fusion protein nucleotide sequence (pBluescript + GST-DHFR-His). (#) indicatesbp location ofenzyme cut: a.EcoRIonly, HindIII only, NotIonly, EcoRI and HindIII, EcoRI and NotI, or HindIII and NotI? b.Briefly explain the rationale for your selection. Please connect your rationale to the need for compatible ends without any further manipulation and required directionality of the DHFR fusion protein coding sequence relative to the T7 promoter that will drive its expression. c.What is the final size(kb)of your desired pDHFR plasmid ligation product based onyour design? d. Complete the chart providedto indicate thesize of all fragments(in bp)resultingfrom complete digestion of each plasmid givenyour strategy, andthe fragment(in kb)from each you would isolate for ligation.Please mind…
A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide pair pergamete.a. Based on this estimate, about how many de novomutations (that is, mutations not found in the genomes of your parents) are present in your own genome?b. Where and when did these de novo mutations inyour genome most likely occur?c. It has been calculated that each sperm made in a25-year-old man is the result on average of about300 rounds of cell division, starting with the firstmitotic division of the male zygote. In contrast,each mature oocyte found in a 5-month-old femalehuman fetus is the result of about 25 rounds of division, starting with the first mitotic division of thefemale zygote. What bearing do these calculations have on the estimate of the rate of base substitutions in humans, and on your answer to part (b)?
. The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?
1. What can you conclude about the base composition and base distribution of G-C base pairs in the bandicootgenomic DNA from this result? Briefly explain how or why you would reach those conclusions.
during bacterial transformation, DNA that enters acell is not an intact chromosome; instead it consists ofrandomly generated fragments of chromosomal DNA.In a transformation where the donor DNA was from abacterial strain that was a+ b+ c+ and the recipient wasa b c, 55% of the cells that became a+ were also transformed to c+. But only 2% of the a+ cells were b+. Isgene b or c closer to gene a?