The basal transcription factor thatrecognizes the TATA, Inr, MTE, andDPE core promoter elements is called:One of it's subunits binds to the TATAbox and is called:[Note: Only the accurate abbreviationas used in class will be scored ascorrect. Note that protein names are inUPPER CASE.] What are the primary functions of eachof the three major eukaryotic RNApolymerases?RNA polymerasesynthesizeRNA polymerasesynthesizeIIRNA polymerasesynthesizeII

Name: The basal transcription factor thatrecognizes the TATA, Inr, MTE, and
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The basal transcription factor thatrecognizes the TATA, Inr, MTE, andDPE core promoter elements is called:One of it's subunits binds to the TATAbox and is called:[Note: Only the accurate abbreviationas used in class will be scored ascorrect. Note th

Answered: The basal transcription factor that…

Science

Biology

The basal transcription factor that recognizes the TATA, Inr, MTE, and DPE core promoter elements is called: One of it's subunits binds to the TATA

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 2P: The Events in Transcription Initiation Describe the sequence of events involved in the initiation of...

See similar textbooks

Similar questions

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
91The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yesorno 92Core polymerase (α2ββ’) use intact double-stranded DNA as a template. Yesorno 93Protein synthesis machinery reads the mRNA nucleotide sequence in groups of three bases or ______________. A.operatorsb.codonsc.open reading framesD.operons
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right.
The Events in Transcription Initiation Describe the sequence of events involved in the initiation of transcription by E. coil RNA polymerase. Include in your description those features a gene must have for proper recognition and transcription by RNA poIymerase.
In prokaryotes, structural proteins in a single biochemical pathway are usually found as a(n) ________ within the genome. a. cluster b. polycistronic transcript c. operon
List the sequences of RNA that would be transcribed from the following DNA template sequences. TTACACTTGCTTGAGAGTC ACTTGGGCTATGCTCATTA GGCTGCAATAGCCGTAGAT GGAATACGTCTAGCTAGCA
In not more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus
Why would it be an advantage to synthesize eukaryotic genes byusing reverse transcriptases to make cDNA?
mRNA maturation in eukaryotes includes all of the following EXCEPT: A. Topoisomerase activity B. Endonuclease C. 5’ 7’methylguanosine D. Polyadenylation E. snRNP function
• Retrotransposons move via an ___ intermediate thatis converted by reverse transcriptase into a cDNAsubsequently inserted into the genome.
Which of the enzymes from the following list wouldyou need to make a cDNA library? What is the function of those enzyme(s) in the process?a. DNA polymeraseb. RNA polymerasec. A restriction enzymed. DNA ligasee. An aminoacyl-tRNA synthetasef. Peptidyl transferaseg. Reverse transcriptase
RNA polymerases generally require a primer to begin transcription. (T) (F) The Death Cap Mushroom Amanita phalloides is toxic because of its ability to produce alpha-amanitin, which is an inhibitor of RNA Polymerases I and III. (T) (F) In bacteria, transcription and translation can occur simultaneously. (T) (F) In eukaryotes, transcription and translation can occur simultaneously (T) (F) RNA polymerase II has no form of proofreading activity. (T) (F) Sigma factors specify binding of bacterial RNA Polymerases to specific promoters (T) (F) An E. coli strain with mutations in genes encoding both the dam methylase and the RecA protein would likely be inviable (dead) (T) (F) An E. coli culture grown in a pure (100%) N2 atmosphere would likely have a lower rate of mutations than a culture grown under normal conditions (~30% O2 and 70% N2) (T) (F) Non-homologous end joining repairs double strand DNA breaks with no loss of information, restoring the original…