Answered: DNA: CATCTACAAATAGCACCTAATTGTG What…

Science

Biology

DNA: CATCTACAAATAGCACCTAATTGTG What would be the MRNA:? Protein? Phenotype?

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 2SQ

See similar textbooks

Related questions

Q: Describe the process of translation, focusing on the role of mRNA, ribosomes, ribosome-binding…

A: All the living cells are made up of protein, which act as building blocks for every organism. These…

Q: explain what happens in transcription?

A: Transcription is the interaction by which the data in a strand of DNA is replicated into another…

Q: Describe the relationships between each of the following: DNA, genes, transcription, translation…

A: DNA stands for Deoxyribonucleic acid. It is a molecule containing our genetic code.

Q: Explain the process of translation, including location, processes, and molecules involved

A: Replication, transcription, and translation are the basic process in the molecular dogma of the…

Q: Describe the function of mRNA, rRNA and tRNA.

A: Functions of mRNA, rRNA and tRNA: DNA has the genetic information stored in it. This information has…

Q: de, translate the mRNA into an amino acid sequence.

A: Translation: It is the process by which sequence mRNA get translated into the sequence of amino acid…

Q: Describe the synthesis and processing of mRNAs.

A: ANSWER;- mRNA is "courier" RNA. mRNA is synthesized in the core utilizing the nucleotide arrangement…

Q: State one role for each of the following molecules in the process of protein synthesis. DNA: MRNA:…

A: Proteins are complex macromolecules that are involved in different body functions. They are produced…

Q: Describe the genetic code and how the nucleotide sequence determines the amino acid and the protein…

A: Genes are the unit of hereditary which are present in a thousand of numbers on the stand of DNA…

Q: Which sequence regarding protein synthesis is correct?a. translation → transcription → mRNA…

A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: explain Translation: From mRNA to Protein

A: The process of translation requires transfer of genetic information from a polymer of nucleotides to…

Q: Put the following steps of protein synthesis in order: STEP A - Anticodon attaches to the mRNA STEP…

Q: The N-terminal signal sequence of a protein is involved in which of the following processes? Protein…

A: A peptide has two ends are N and C terminal. The terminal with a free amino group is known as…

Q: n the process of transcription, the input is and the output is O tRNA, DNA O MRNA, protein O DNA,…

A: the central dogma of molecular biology suggest that biological information flows from DNA to RNA to…

Q: The process of transcription and translation help to crate which type of macromolecules

A: Given: To find which macromolecule is produced during the process of transcription and translation…

Q: Synthesis of RNA from the instructions in DNA is called________ . Synthesis of a protein from the…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: In protein synthesis, DNA transcription records the genetic message, while ribosomal ______________…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: Explain the roles of DNA, mRNA, tRNA, and rRNA in theproduction of a protein

A: Proteins are large biomolecules that play a significant role in the physiological activities of the…

Q: Summarize the functions of mRNA, rRNA, and tRNA.

A: RNA is a ribonucleic acid that helps in the synthesis of proteins in our body. This nucleic acid is…

Q: describe how ribosomes, mRNA, and tRNA cooperate to produce a protein?

A: Ans: The proteins are synthesized from mRNA using the process called translation, which involves…

Q: An mRNA molecule codifies only one type of protein?

A: mRNA (messenger RNA) molecules are also known as transcripts that carry the coding sequences for the…

Q: During protein synthesis, which of the following are involved in the steps that take place in the…

A: The central dogma of life is as follows DNA - RNA - Protein Thus to make protein we require RNA…

Q: Which of the following statement about RNA is FALSE? rRNA is critical for protein synthesis as it is…

A: Ribonucleic acid (RNA) is a nucleic acid which has similar features to DNA and is found in all…

Q: Put these events of protein synthesis in the correct order First [Choose] [Choose ] RNA nucleotides…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: What does mRNA copy from DNA? * One gene's worth of nucleotides One chromosome's worth of…

A: Transcription is the process of synthesis of mRNA from the DNA. It takes place in the nucleus.

Q: Describe the roles of ribosome, mRNA & tRNA 's in translation

A: Introduction :- The mRNA contains a series of codons that the ribosome decodes to produce the…

Q: During which process is MRNA synthesized from a DNA template with the aid of RNA polymerase? O…

A: Introduction Genome is referred to the total amount of DNA a single haploid cell contains. Genome…

Q: Describe the process of protein synthesis and localize where each step takes place.

A: Protein synthesis is the process wherein cells make proteins. It happens in two phases:…

Q: Using a diagram, outline the structure of a ribosome, including protein and RNA composition, large…

A: Ribosomes are sphere shaped structures located within the cytoplasm of a cell. They remain free in…

Q: Describe the process of translation and transcription.

A: By activating the enzyme RNA polymerase, the DNA strand is converted into mRNA during the…

Q: discuss comprehensively the overall process of protein synthesis through transcription and…

A: The expression of the genetic material occurs through the proteins. This are transcription and…

Q: What part of the protein sequence leads to different functions

A: Proteins are peptides , composed of monomers of polymers,Protein function is directly related to the…

Q: During transcription of protein synthesis, a(n), is made and during translation, a(n). is made

A: Ans 8. Transcription means the act of copying the information on a DNA strand into a new messenger…

Q: What is Translation? Where in the cell does it occur? What are the steps of this process (briefly) .…

A: The translation is one of the two processes by which gene expression takes place. Gene expression…

Q: Put the function of mRNA is blank

A: Replication is the process of formation of identical copies of DNA. Transcription is the formation…

Q: Define DNA, genome, gene, stem cells.

A: DNA is a molecule that was discovered in the late 1860s by Friedrich Meischer in the nucleus but its…

Q: The primary structure of a protein is ultimately determined by an MRNA molecule an FRNA molecule O a…

A: The primary structure simply means the sequence of amino acids in a polypeptide chain. By the…

Q: DNA G CU MRNA T U GOOC ERNA fethionine Amino Acids NA is synthesized in translation or…

A: Transcription is the process in which DNA forms m RNA and translation is a process in which protein…

Q: What is translation and transcription

A: Central dogma: a. The biological information passes from DNA to RNA and then to protein. b. It is…

Q: Which biomolecule contains Deoxyribonucleic acid; a sequence of bases that makes hereditary code;…

A: There are two types of genetic material in plants and animals. They are DNA and RNA, deoxyribose…

Q: Please draw the protein synthesis

A: Introduction Protein synthesis, also known as protein biosynthesis, is a fundamental biological…

Q: Discuss and explain the process of protein synthesis.

A: The central dogma of molecular biology suggest that the DNA is converted into an RNA by the process…

Q: Explain the process of Transcription and Translation.

A: Fragments of DNA that are responsible for different traits are known as genes. The expression of…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

DNA: CATCTACAAATAGCACCTAATTGTG What would be the MRNA:? Protein? Phenotype?

Definition Definition Observable physical traits or characteristics of an organism, which are determined by its genetic makeup (genotype) as well as environmental factors. These traits can include anything from eye color or height to behavior or disease susceptibility. Understanding an organism's phenotype is important in fields such as genetics, medicine, and ecology.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Describe the process of protein synthesis and localize where each step takes place. Make sure to describe and use the following terms: Translation: mRNA to proteins (cytoplasm) mRNA w/codon, ribosomes, tRNA w/anticodon and amino acid, protein with 3D structure
Describe the process of protein synthesis and localize where each step takes place. Use the following terms: Transcription:DNA to mRNA (nucleus). Gene, Transcription factors, RNA polymerase, complementary base pairs (A-U), mRNA editing
Describe the process of translation and transcription.
A piece of DNA reads ATGTTATAACCC. If this sequence is transcribed what will be the resulting mRNA sequence be?
Describe the processes of transcription and translation from DNA to polypeptide chain.
Describe the relationships between each of the following: DNA, genes, transcription, translation and polypeptide (or protein).
Work out the RNA and amino sequences
If a strand of DNA has the sequence A T G C G A TC C G C, then the sequence of an mRNA moleculetranscribed from it is .
Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: C G A T A C A A T G G A C C C G G T A T G C G A T A T C C mRNA: Codon: Anitcodon: Amino Acids:
Synthesis of RNA from the instructions in DNA is called________ . Synthesis of a protein from the instructions in mRNA is called________ . Which structure in the cell is the site of protein synthesis?_________
explain what happens in transcription? explain what happens in translation? Explain how they relate to each other ( organelles) and to their role in the cell. (what are they necessary to produce in the body)?
What would be the mRNA strand if the DNA strand reads: T A C C G A G T C A C G?